Alabama Fishes Research

A New Year, With New Projects

2012-01-22T16:08:00.000-08:00

I went out today and last Sunday on two different projects. Last week we attempted to start Candice's project, to monitor flame chub reproductive biology. Flames seem to spawn earlier than most other local cyprinids, so it seemed to be a good idea to pick some up in January. A big potential problem this time of year is that of course streams are higher, with lower temperatures and no leaves on trees to suck up water. But, we went to Little Paint Rock Creek in Marshall County and Larkin Fork of the Paint Rock River in Jackson County. At Little Paint Rock Creek we caught one female flame chub, along with large numbers of blacknosed dace and bluntnose minnows. The one basin at this site where I've typically caught flame chubs had deep water with lots of sediments on the bottom, not a good combination for any kind of netting. And Larkin Fork had more water in it than I've seen before. The specific site we visited is my "guaranteed" flame chub site, with fish in a small rivulet flowing from a spring field under the road and down in to the Fork. On our visit, the spring field was a flowing creek for several hundred meters, almost knee deep. We caught dace in these areas, along with bluntnose minnows and striped shiners, but nary a flame chub. So, hopefully we'll get out next Sunday with lower water if the rain holds off a bit.

Here's a photo of the county road running along Larkin Fork, with my "sweet spot" in the middle.
Today I drove out to Borden Creek in the Sipsey Wilderness to start a new driftnet project with Rebecca. The manuscript Brittany and I submitted to Southeastern Naturalist was rejected, basically because they thought our taxonomic treatment was too coarse and we weren't bouncing off of recent literature. I'm sorry for that, but the rejection comments and several published articles gave me some ideas on how to do this new project in a better fashion. We're running two simultaneous nets, one at the base of a riffle and the other in what's now a glide but in summer will be more of a pool habitat with slower current. Rebecca's mission will be to describe and measure length and width of everything we catch so that we can quantify the energy input of the drift biomass. It's possible to calculate mass from these measurements using several algorithms, and knowing mass allows the calculation of the energy content of the drift. Luckily the new stereo microscope will make this possible by photographing everything and using the software to measure drift length and width. We'll make these collections on a seasonal basis, so as not to completely overwhelm Rebecca. I have a permit from the Forest Service to run the driftnets, with the condition we make sure that we're not trapping mussel glochidia in the drift.

Here's an upstream view of the creek today, with our riffle driftnet just about dead in the middle of the image. You might see the two dowels sticking up, or the white of the top crossbar of the net. A nice thing about Borden Creek is being able to drive the dowels in to a sandy bottom, unlike the Flint River.

Here's the downstream, "glide" site net in position in slightly deeper water. A pretty violent riffle starts just downstream from it, with whitewater running over some big rocks at the top of the riffle. Measured current velocity at this site was about 0.1 m/s, and flow at the upper site was about 0.25 m/s, both tame by the standards of the Flint River last winter.

Silver Shiner/Banded Darter Manuscript Out On Review

2012-01-04T17:50:00.001-08:00

I heard from an editor at Southeastern Naturalist today, they've decided to put out manuscript out on review. That's a good sign. Now I have two manuscripts on review at SENat.

I applied for a permit to do driftnetting at Borden Creek in the Sipsey Wilderness. Jera, the Forest Service biologist I sent the application to, asked if we would be able to avoid catching the drifting glochidia (larvae) of endangered mussels in the creek. Probably not, because they're about the same size as some other animals we catch (about a mm or 2), but then I thought that we'd never seen any in driftnet collections from the Flint and Paint Rock rivers. Do we just not catch them, or do we mash them up beyond recognition in emptying the driftnet? I would know one if I saw it. Hopefully this question won't hang up our application; I don't know what listed mussels are in Borden Creek although it doesn't surprise me that they might be present. If they grant a permit, I hope to start this project on Jan. 22, the day before the next new moon. Borden Creek is such a beautiful site I look forward to doing this project.

Silver Shiner & Banded Darter Manuscript Submitted To Southeastern Naturalist

2011-12-22T10:51:00.000-08:00

I just sent the manuscript, "First Records of Notropis photogenis (Silver Shiner) and Etheostoma zonale (Banded Darter) in the Flint River, Alabama", to the journal Southeastern Naturalist. It's formatted as a Note, a short article, in this case describing finding these two species in the Flint River, and briefly why it's significant. Brian Thompson is the co-author. As always, I hope they like it. The Abstract follows:

Notropis photogenis (Silver Shiner) and Etheostoma zonale (Banded Darter) were collected from the Flint River in Madison County, Alabama, a northern tributary to the Tennessee River. Both species have been found in other northern tributaries to the Tennessee River in Alabama, but have never been reported from the Flint River. Because of its sensitivity to anthropogenic pollution, the Silver Shiner deserves Special Concern status in Alabama.

New Dissecting Microscope

2011-12-19T06:43:00.000-08:00

I now have a new Olympus SZX7 dissecting microscope with a high-quality camera built in to it, and a dedicated PC to handle the images. I hope to use this both on another driftnet project at Borden Creek in the Sipsey Wilderness, and also with gonadal tissues of silver shiners and blotched chubs. Hopefully the learning curve won't be too long.

The 11-KT Paper Has Been Accepted

2011-12-04T17:17:00.000-08:00

The paper by Jennifer and me, "Investigation of the Relationship Between the Steroid Hormone 11-Ketotestosterone and Reproductive Status in the Fish Lythrurus fasciolaris", has been fully accepted by American Midland Naturalist. It will be in the July 2012 issue. I'm glad to be able to get it into print, since it was a lot of work and shows some interesting things about the scarlet shiner. With any luck I can do some more work along these lines, but it takes some money and even more importantly someone willing to do a lot of detail-oriented work. Anyway, here's the final Abstract for the piece:

In teleost fishes, 11-ketotestosterone (11KT) is a critical androgen regulating primary and secondary sex characteristics. In the sexually dimorphic Lythrurus fasciolaris (Cyprinidae), dominant nuptial males display heavy tuberculation on the head and nape, dark dorsolateral vertical bars, and dramatic red coloration in the fins, venter, and operculum area. This study aimed to quantify 11KT circulating levels in males and females, and determine any correlation with key male reproductive status indicators such as nuptial coloration, size, and gonadosomatic index (GSI). Thirty-one wild-caught L. fasciolaris were divided into three groups according to reproductive status: dominant males (D), non-dominant males (ND) and females (F). Physical measurements, digital imaging, and blood samples were used to quantify body size, GSI, nuptial coloration, and 11KT circulating levels. Dominant males had higher 11KT levels and nuptial coloration traits compared to ND males and females (red area, hue, saturation), and a higher GSI than ND males. Non-dominant males had more 11KT and coloration than females. Increased 11KT levels corresponded to increased coloration, size and GSI.

Cyt-b Gene Sequence Of A Fundulus From Chipola River, Florida

2011-11-10T17:26:00.000-08:00

I have a growing number of cytochrome-b gene sequences from a group of Fundulus fish in the lower Appalachicola basin of the Florida panhandle. These are starhead topminnows with a distinctly different phenotype from either F. lineolatus to the east, or F. escambiae to the west. Here's one of the complete 1140 base sequences of a fish from the Chipola River. It hasn't gone through any kind of review, but this is based on a really clean PCR and sequencing with standard primers. Here it is, in 5' to 3' order:

ATGGCAAACCTTCGAAAAACCCACCCCCTTTTTAAAATCGCAAACGACGCTCTA
GTAGACCTACCAGCCCCCGTAAACATTTCCGTGTGATGAAACTTTGGATCCTTA
TTAGGATTGTGTTTAATTGCCCAAATTTTGACCGGGTTATTTTTAGCTATACAT
TATACTTCTGATATTTCTACAGCCTTCTCATCCGTCGCACACATCTGCCGGGAT
GTAAATTATGGCTGGTTAATCCGTAATATACATGCCAATGGTGCTTCCTTCTTT
TTTATCTGCATCTACCTTCACATCGGACGTGGTTTATACTACGGCTCCTACCTT
TATAAAGAAACATGAAATGTAGGTGTTATTTTACTGCTCCTAGTTATGATGACT
GCCTTTGTAGGATACGTTCTCCCTTGGGGCCAAATATCTTTTTGAGGTGCCACC
GTTATTACTAACCTATTATCCGCAGTTCCTTACGTAGGAGATGCATTAGTACAA
TGAATCTGAGGGGGCTTCTCAGTAGACAACGCCACACTCACCCGGTTCTTCGCC
TTCCATTTTCTACTACCCTTTGTAGTGGCAGCCGCTACTATAGTCCACTTAATT
TTTCTTCATGAAACCGGTTCAAACAACCCCATTGGCCTAAATTCCGACGCCGAT
AAAATTTCCTTCCACCCATACTTCTCTTACAAAGATCTCCTAGGTTTCGCTCTC
CTTTTAGCAGCCCTAATCTCCCTAGCCTTATTCTCCCCCAATCTCTTAGGGGAC
CCAGAAAATTTTACTCCAGCTAACCCCTTGGTAACTCCCCCTCATATCAAACCA
GAATGATATTTTCTCTTTGCTTACGCTATTCTCCGATCTATTCCTAATAAACTG
GGTGGGGTCCTAGCCCTGCTAGCATCAATTCTTATCCTAATAGTCGTCCCTATT
CTTCACACATCTAAATTACGAAGTCTAACTTTCCGCCCTCTATCCCAATTCTTG
TTTTGACTATTAGTGGCTGACGTCGCAATCCTAACATGAATTGGTGGTATACCA
GTAGAACATCCCTTTGTGGTTATTGGACAAGTTGCCTCCGTCCTATACTTTTCC
ATTTTCCTGTTTCTTTCACCCGCCGCAGCGACATTAGAAAATAAAATTCTCCAA
TAATAA

Silver Shiners At Another Flint River Site

2011-11-03T17:40:00.001-07:00

Last Sunday we went to a new site on the Flint River, about 5 km downstream from our more typical spot. I've been curious if silver shiners exist downstream, and ultimately how far downstream. This site is accessible through a subdivision, with a key needed to get through a gate and down a road that ends right at the river in a picnic ground. One of my student's parents live in this subdivision, so he was able to get a key. And that is a good thing! The river is really beautiful at this site, with steep bluffs on the east bank, a long thin island with steep banks, and more gradual slopes from the west. The first picture is a downstream view from our access point, with Alex and Monica walking to the point where we were able to catch silver shiners with a castnet. Even at low water, the center flow of the river was fast and maybe two-thirds of a meter deep.

Here's most of the group taking a break in the sun. The water was 12 deg. C, and air temperature started lower than that.

An interesting feature of this site is a springfield of about three significant springs, and maybe six smaller ones, bubbling up through the stream bottom with other smaller "jets" of water. The area was maybe 150 square meters, protected from the main flow of the river by a projecting bank. The water was shallow with heavy vegetation. I didn't have the chance to really look, but it seemed to be ideal flame chub microhabitat. This photo was from the opposite side of the river. You can see a pumphouse about halfway up the low bluff, connected to two intake pipes at one of the biggest spring flows. I have no idea who owns that rig.

Here's a view of the river-facing edge of the subdivision. The houses are built on a low natural bluff that I'm sure is above the level of any recent floods. A broad swath of mowed lawn functions as a buffer. Builders don't always resist the temptation to put houses closer to the river in clear danger.

And, here's some of the catch of the day. The two skinny fish with some dark lines on their top running lengthwise are the first two silver shiners of the day. The tiger striped fish at 4 o'clock is a logperch, later released. And the fish at 11 o'clock is one of the largest northern studfish I've ever seen, which I kept for possible DNA examination. We wound up with six silver shiners, five of them caught with the castnet. We also caught some whitetail shiners, a few of which I kept as vouchers. And two seine hauls came up with 30-40 scarlet shiners each, all of which we released. I hope to return to this site over Thanksgiving weekend, water level permitting.

The Flint Last Weekend

2011-10-24T16:56:00.000-07:00

Last Sunday, Oct. 16, we went out to our regular spot on the Flint to catch silver shiners and blotched chubs. We found the chubs easily enough, but we only found one silver shiner. So, hopefully this Sunday, we're going to explore some new spots downstream on the chance that the silver shiners are more common there, as well as just to find new legal, easy access point. Below are Josh and Robert transferring captured fish into our first jar with very dilute formaldehyde.

Here's a view downstream, it was a beautiful sunny day in the 70s F. I suspect that this was our last trip for the season without waders.

Manuscript Fun, And DNA Ready To Be Sequenced

2011-10-13T16:54:00.000-07:00

I submitted our manuscript on driftnet observations in Estill Fork to the journal Hydrobiologia, and they responded with a polite decline. The editor stated a rather odd reason for the decline; that the work suffered from "low taxonomic resolution". We identified and analyzed the collections to taxonomic Order, as has been done in about every other even vaguely similar research project including many in Hydrobiologia. I thought about arguing the point with the editor, but I don't have time to waste exchanging pleasantries with this dude. So, I resubmitted it to Southeastern Naturalist. Hopefully they won't have any similar bouts of cognitive dissonance.

The 81 DNA extractions that I have from various Fundulus fish are now ready to go to Lance's new company, Oblique Genomics, for sequencing. He's going to pick them up tomorrow morning. I've never had a DNA service company offer to do a pick-up. If they all work, I have a lot of work ahead with massaging the sequences and making sense of them within the several projects represented.

Soon Come...

2011-10-09T13:12:00.000-07:00

I think I have a complete set of Telogia Fundulus DNA extractions ready to have sequenced. This includes known F. lineolatus and F. notti, the species to the east and west of this location. Assuming that all goes well, then I'll have to do the editing on the raw sequences so we'll have all 1140 bases in the cyt-b gene and plug it into Mr. Bayes for treebuilding.

On a paraellel track, I think I've figured out what I want to do in Panama next May on my return trip. The Smithsonian has a small field station in the Fortuna Protected Area in Chiriqui Province near the Costa Rican border, up in the cloud forest at 1100 m elevation just on the Pacific side of the continental divide. At that elevation the weather is like a North American spring, rarely hot and with lots of rain. My plan is to work the drainage system of the Rio Chiriqui that starts there looking for Brachyrhaphis populations and ultimately their parasites. I also hope to visit the other side of the divide in Bocas del Toro province, draining to the Caribbean. The point of this work would be to assess both host population and species patterns, and look at the parasites which usually coevolve with the host. So we might only spend three days in Panama City this time before heading way to the west. This all has to be approved by the Smithsonian, of course, but I think they'll like it. This time I already have a Perfect Dipnet and the relevant vaccinations, so the preparation should be easier. Y en espanol: aun falta mucho.

Last Driftnetting At The Flint Last Sunday

2011-10-02T09:44:00.001-07:00

It's only taken a week, but here are some photos from last Sunday's trip to the Flint River. This was our last driftnetting session for this project, we now have a full year's worth of collections from last October. We also were interested in netting more silver shiners and blotched chubs. The driftnetting went well, with fairly low water. But it was a lot harder this time with the silver shiners; we only caught 11, half of them by Josh with a cast net. And we also netted 18 blotched chubs, along with 1 bigeye chub that we kept by mistake.

This first photo is of Josh watching Jeremy and Kelly cross the river to pick up some gear we'd left there as we prepared to leave. Even in low water it's a challenge to walk across the broken bedrock.

Here's a view of Josh with downstream behind, down to the old bridge supports. The best place to catch silver shiners is along the far bank in the medium distance.

And of course, a view of the Winchester Road bridge as a standard for gauging river height and flow. The river was just about at the median height and flow for the date over 12 years, according to the USGS online river monitor.

Our Last Transecting Trip To Estill Fork

2011-09-26T15:58:00.000-07:00

Five of us went out to Estill Fork in the upper Paint Rock River valley on Saturday. This trip completes the field work aspect of both Robert's and Brian's thesis projects. We have a full year's worth of several darter species for Robert's examination for gill parasites, and we've completed 7, I think, visits to Estill Fork for Brian's transect examination of physical habitat and darter usage. It was a beautiful early fall day, warm and sunny, and I'm not sure we really broke a sweat doing this work. The first photo below is my standard view of the low bridge across the stream looking east, from the perspective of where we park.

The stream had low but flowing water. Much of the streambed was covered with water willow, usually with several inches of water flowing around the base of the plants.

Many of the autumn blooming plants were in flower. Below is a cardinal flower plant. They prefer really wet soil right on the edge of a stream, and there were a lot of them at this site in such soils.

I know I know what the next plant is, but the name escapes me. (Edit: They're blue Lobelia, a relative of the cardinal flower.) They're found along the stream in drier, more elevated soils than the cardinal flower.

All sorts of asters were in bloom, of course, this being late September. I'm sure someone could tell me exactly what species is in the next photo.

This view of our vehicles makes it look like we're parking in a meadow, but we're actually off the roadway between two large meadows. It looks very autumnal, of course.

And finally, here's a high-contrast view of the stream itself, shadows mixing with spots of bright sunlight breaking through the canopy. The water was extremely clear.

Manuscript Fully Accepted At Southeastern Naturalist

2011-09-21T09:32:00.000-07:00

It's been too long since I last posted. My immediate spur is hearing from Anne, the editor at Southeastern Naturalist, that the article by Andrew, Brittany and me on gill parasite infection in telescope shiners has been fully accepted, and should come out in print in 3-6 months. I have to thank Don Cloutman for working with me as the guest editor for this paper, improving it hugely. Following is the final Abstract for the article:

Dactylogyrus is a holarctic genus of monogene flatworms that infects the gills of cyprinid fishes. Dactylogyrus species are usually highly host specific, and little is known about their life history in North America. The purpose of this study was twofold: to determine whether Dactylogyrus exhibits seasonality in its life cycle, and if there is any effect upon reproductive effort of the host as a result of Dactylogyrus infection. Over a 12-month period, 967 Dactylogyrus were found on the gills of 383 Notropis telescopus (Telescope Shiner), a cyprinid fish collected in the upper Paint Rock River system in northeastern Alabama. A significant positive relationship was found between host somatic weight and prevalence of infection, and a significant positive correlation between higher intensity of infection and gonadosomatic index (GSI). The assumptions that parasites are evenly distributed among individual host fish and in each month were rejected by chi square tests, with the months of March through July as a peak for the extent of Dactylogyrus infection. These months are the time of gonadal development and reproduction in Telescope Shiners.

Photos From Estill Fork On August 26

2011-09-11T18:10:00.001-07:00

I went to Estill Fork last Aug. 26 with Robert, Alex and Jeremy to collect darters for Robert's gill parasite project. We were able to collect a good number of stripetails, and enough rainbows and redlines to make it worthwhile. The water was way down since it hadn't rained for three weeks, as seen in the photo below -

Robert and Alex are hanging out on the bank as we prepare to pack up the darters in very dilute formaldehyde to take home on ice.

Robert makes sure the euthanized darters are in enough of 1/4000 formaldehyde before putting them on ice.

We'll have to return later this month, for the last darters for Robert's project, and to do the last transect for Brian's project. The stream should be somewhat higher with the almost 15 cm of rain we've received so far this month.

A Manuscript For My Friends At Freshwater Biology

2011-09-03T18:05:00.000-07:00

Yesterday I submitted the manuscript based on Brittany's thesis work to Freshwater Biology. It has the very direct title of, "Invertebrate Drift in Estill Fork, Jackson County, Alabama" with Brittany and me as co-authors in that order. FB has published other studies of stream drift, so hopefully they'll like ours, too.

We've organized the silver shiners (28) and blotched chubs (32?) from last Sunday, starting with basic length/gross weight measurements and giving each individual a name and an attached paper tag with that name. Some of the chubs are obviously this year's young-of-year, and I think three of what we've ID'd as silver shiners are juveniles, too. I hope that we can establish year classes by length bins, examine patterns of gonadal maturation come late winter and spring, and observe gill parasite infection patterns and rates. From what I can tell the silver shiners are especially poorly studied, so I think such a project can make contributions to our knowledge of these species and their ecosystems.

To The Flint Last Sunday

2011-08-30T20:05:00.001-07:00

I think 10 of us made it to the Flint on Sunday to run a trifecta: driftnetting, transects for darter habitat niche, and collecting silver shiners and blotched chubs. It was a beautiful day with low water, and we finished everything in just over 4 hours. One thing I've learned about silver shiners is that they travel in tight schools; if you catch one, you'll probably catch nine. We ended with 28 of them, including 3 subadults, and about 30 chubs. We plan to check both gonadal condition, and the status of gill parasites.

I'm now up to 40 DNA extractions on the Telogia project. Once I get the sequences all I have to do is analyze the data... it will be interesting one way or another.

Robert and Kara spent time with the confocal microscope trying to get informative images of gill parasites. My colleague Lynn was very impressed with what she saw of the images, but Robert didn't seem as happy; I still have to see them myself.

Yeah, More DNA!

2011-08-23T18:02:00.000-07:00

My big accomplishment of the week to date is 6 DNA extractions yesterday, and 6 more today, so that I've done 28 now that are ready to be sequenced. Thursday I might get crazy and try to do another 12, the maximum I can do at once because I'm limited by the number of tube slots in the tabletop centrifuge. It's like real biology!

We're also starting to organize for a life history study of both silver shiners and blotched chubs from the Flint. Four students are interested in working on this project (one of them a volunteer), so hopefully this will fly. I'll have a better idea after Sunday's trip to the Flint.

With The New School Year...

2011-08-21T18:40:00.000-07:00

With the new school year I'm definitely off and running. I have three students who are willing and hopefully able to work on examining both silver shiner and blotchside chub populations in the Flint River, the basic stuff like length, sex, and reproductive condition. I also hope that we can establish how widespread the silver shiners in particular are in the river. Another student has volunteered to look at gill parasites in the silvers; I talked to Don Cloutman from Bemidji State the other day and he told he that he has described Dactylogyrus gill parasites from more than 200 North American cyprinids including the silver shiner, and with that he's about ready to retire apparently.

Others are working on the driftnet project (two more months to go) and on the Brachyrhaphis I collected in Panama. So it could be good for raw data generated.

And meanwhile Brian and Robert are close to finished with their field work on darters and will hopefully defend in the spring.

We plan on doing a big day on the Flint next Sunday, with driftnetting, transecting and netting for silver shiners and blotchside chubs. As long as we can park in a secure, convenient place it should be almost easy....

I've Been A Boring DNA Extractor

2011-08-15T17:03:00.000-07:00

I now have a total of 16 DNA extractions related to the Telogia project. Six of them were done today. It requires a 3-hour water bath incubation at 55 deg. C at the beginning to give the protease opportunity to break down the cells and especially the nucleus. Since school begins Wednesday, I was able to use these three hours to talk to a bunch of different people about courses, teaching intro biology labs, and general business before I had to duck out and get back in the lab for the last stages of the process that involve cleaning and concentrating the DNA product. If I have a whole day open I will try to do 12 at once, my limitation since our countertop ultracentrifuge only has a capacity for 12 tubes, and much of this process involves short centrifuging bursts. After three rounds with this extraction kit I think I almost know what I'm doing, and I haven't dropped or blown up any tubes.

One and maybe two students are seriously interested in working on a project to describe the life histories of the silver shiner and blotchside chub in the Flint River. My plan is to take 20 roughly monthly, and monitor size classes, sex ratio, and gonadal development in the spring. The trick to this will be what we can do over the winter when the river is higher and faster (besides be careful!). There's some literature on the silver shiner's life history at the extreme northern edges of its range in Michigan and southern Ontario. One broad question we will try to address is how different is the species' life history here at the extreme southern edge of its range. It could be fun!

Now I Have 4 cyt-b Sequences, And On To A Silver Shiner Project

2011-08-09T10:34:00.000-07:00

I now have four entire cyt-b DNA sequences, from Fundulus heteroclitus from Warwick, RI, and Oyster Pond (Cape Cod), MA, and from an F. similis from St. Joe Beach, FL, and an F. diaphanous from Warwick, RI. The latter is markedly different from the others, not surprising since the species is more distantly related to the others.

We hope to begin a population study of silver shiners, Notropis photogenis, from the Flint River. The hope is to document size and age classes, and also reproductive effort measures such as GSI. I think the species has been best studied at the far northern edge of its range in Michigan and Ontario, so we'll attempt some of the same studies here at the far southern edge of the range. By coincidence, I met a student yesterday who told me of a fairly easy river access point on Ryland Pike about a mile downstream of where we've been working, that could be useful information.

Another Sequence, And I've Finally Begun The Telogia Fish

2011-08-02T19:56:00.000-07:00

I stitched together a second cytochrome-b gene last night, all 1140 bases, from a mummichog from Oyster Pond in Falmouth, MA, on the Cape. It differs by only one base from a mummichog from Maine whose sequence I have. I also have sequence data from a mummichog from Rhode Island that I'll do next, I'm curious to see if it's more different from the Maine fish.

And I finally started today for real on setting up the fish from the Telogia collection for sequencing. I'm pulling out a few fish from each of the 10 locations we have, measuring them, giving them a name like TCR1, and each fish gets its own screw-cap test tube with 95% ethanol until I cut off a small piece for DNA. We'll see how the cyt-b sequences turn out on these fish, hopefully sooner than later.

I Finally Have An Entire Fundulus Mitochondrial cyt-b Gene Sequence

2011-07-31T16:54:00.000-07:00

Lance and Anthony at IXG came up with a third sequencing primer for getting the entire 1140 base cytochrome-b gene from several Fundulus species. The one below is from a longnose killifish, F. similis, from St. Joe Beach, Florida. It's the first of my batch of five. I've stitched it together from three overlapping sequences from the three different primers. And, it's published here first!

ATGGCAAACCTTCGAAAAACCCACCCCCTTCTAAAAATTGCAAACGACGC
TTTAGTGGACCTACCAGCCCCTGTAAATATTTCCGTATGATGAAACTTTG
GTTCCCTATTAGGCTTATGCTTAATTGCCCAAATTTTAACAGGATTATTT
TTAGCTATACATTATACTTCTGACATTTCCACAGCCTTCTCATCTGTTGC
ACACATCTGCCGAGATGTAAATTACGGCTGATTAATTCGTAATATACACG
CTAACGGAGCCTCTTTCTTTTTTATTTGTATTTATATTCATATTGGGCGA
GGCTTATATTATGGATCGTATCTTTATAAAGAAACATGAAACGTAGGGGT
TATCCTTCTTCTCCTAGTTATGATGACTGCTTTCGTTGGATACGTTCTTC
CCTGAGGACAAATATCCTTCTGAGGGGCCACCGTTATTACCAATCTCCTG
TCCGCCGTCCCTTACGTAGGAGATGCACTGGTACAATGAATTTGAGGGGG
TTTCTCAGTAGATAATGCTACACTAACCCGATTCTTTGCCTTCCATTTCC
TCTTCCCATTTGTCGTAGCAGCTGCTACTATAGTACACTTAATTTTCCTT
CATGAAACAGGATCTAATAATCCAACGGGTTTAAACTCCGATGCAGATAA
AATTTCATTCCACCCTTACTTTTCTTACAAGGATATTCTAGGTTTTGCCC
TTCTTCTAGCAGCCTTAATTTCTTTAGCCTTATTTTCCCCTAATCTCCTT
GGAGATCCTGATAACTTTACACCAGCCAACCCTTTAGTTACTCCCCCTCA
TATCAAGCCTGAATGATATTTCCTTTTTGCCTATGCTATTCTTCGATCCA
TTCCTAATAAACTAGGAGGAGTATTAGCCTTATTAGCATCTATTCTTATT
CTTATGGTAGTTCCTATTCTTCATACATCTAAACAACGAAGCCTTACCTT
CCGACCTCTAACCCAATTCCTATTTTGACTTCTAGTAGCAGATGTTATAA
TTCTTACCTGAATTGGTGGTATACCTGTAGAACACCCCTTCGTAATTATT
GGTCAGGTTGCTTCCTTCCTCTATTTTTCCCTATTCCTGTTTCTCTCTCC
TGCCGCAGCATGATTAGAGAATAAAGTCCTTGGATGATAA

We Found Fish And All That At The Flint

2011-07-29T18:34:00.000-07:00

We put the new flowmeter to work at the Flint River today, and all is well. I had to leave after the first transect (following driftnetting) to go to a Master's report presentation. On that transect we found a bunch of banded darters in the middle of the river, a few scattered black snubnoses, and then a bunch of redlines in the fast flowing side channel over gravel and cobble. It was an impressive example of niche partitioning.

I got DNA data back from IXG, it looks like the third primer they designed for me for sequencing the mitochondrial cyt-b gene of Fundulus species works. I still have to open up that data set and look closely, but I think what they sent me fills in the gap in the middle of the sequence. So now I can move on to the Telogia fish, I hope!

Everything's OK, I Have A New Flowmeter

2011-07-27T16:58:00.000-07:00

The new flowmeter arrived yesterday. The only difference between it and the original one is that the new one came in a green rather than a red box. We'll use it on Friday at the Flint, where we'll attempt to do both driftnetting and transects for Brian. The challenge will also be to park in a believable place since the Farmer's Market doesn't want us to park on the edge of their property anymore. We can park over by Brier Fork and march down, which in warm weather isn't so bad. We'll see what happens this winter.

I also heard from the journal American Midland Naturalist about the 11-KT in scarlet shiners manuscript Jennifer Schade and I submitted last winter. They're happy to publish it with, of course, the caveat of some revisions. It's always humbling to see what clunkers you leave in a manuscript for other people to find (like spelling Anderson as Andeson in the Bibliography). But it's a fairly short list, so I hope we can turn it around and send it back to them in a month or two.

A New Flowmeter Is On The Way

2011-07-21T11:07:00.000-07:00

I've had an adventure the last two days trying to order a replacement flowmeter since I think we drowned the old one last Friday. I called Forestry Suppliers in Jackson, MS, to try to order one from them since I got the original one from them last September. It didn't show up on their on-line catalog, and the person I talked to on the phone wasn't familiar with it, nor were the available techs she asked; one finally said they used to carry it. So OK, I'll just order it from the Geopacks HQ in Devon, England. The Geopacks phone number wouldn't connect, although I could get their FAX phone, and I finally sent an email to their service department. They were willing to sell me one and ship it, but the lady I corresponded with found it odd that Forestry Suppliers didn't have one since Geopacks continues to ship to them. Geopacks called Forestry Suppliers, found out that they did indeed have this flowmeter, and they sent me an email with a name and number to call. The lady at Forestry Suppliers was apologetic, connected me to their sales line, and I ordered a new flowmeter just an hour ago that I should have early next week. Phew! We need it for going out to driftnet in the Flint next weekend on the new moon, and we're also due to run transects there for Brian's work. So all's well for the moment.

Transecting In The Rain

2011-07-16T17:01:00.000-07:00

We made it out to Estill Fork yesterday to do our transect sampling for Brian's project. The stream was still high from rains the previous two days. We were able to finish three of the typical eight transects we do before a sustained rainfall started. That was OK, we're tough and all that, but the flowmeter got a little wet at the connecting jack and stopped working, which pretty much ended the day since a key part of the working is relating stream flow to darter presence. I have it drying out in a dessicator jar, and hopefully it will work again without any heroic electronic work. It's a fairly simple device, but if it's dead we seriously face having to buy a replacement to finish this work, a mere $250. We were catching interesting fish even in the relatively deep water, including several blotchside logperch, a surprising number of greensides, and along with the usual suspects we caught johnny and blueside darters. I think we did enough work so that the data will suffice, even a little bit short. My cell phone got a little wet and stopped working too, even in a cooler, but luckily has snapped back.

Yeah, There Are Lots Of Silver Shiners In The Flint River

2011-07-12T18:52:00.000-07:00

I went out this afternoon with the Ichthyology class to our Flint River site with a primary goal of catching more silver shiners. My guess was that they would be in the slightly deeper flowing water over sand just below the riffles we usually work, and sure enough, we caught 16 very quickly (along with a 6-inch smallmouth bass). I kept 9 of these fish, 3 in ethanol and 6 in buffered formaldehyde, as vouchers of their existence. In one net alone we caught 12, at which point we stopped. So, once again, we found what is one of the most abundant species in the river but has been unreported as being present. Just like most fishes the silver shiner has a very specific habitat preference, described above, and when we set up a seine in that habitat there was obviously no shortage of the species. This is the second well-documented site for this species in Alabama, along with Sugar Creek off of the Elk River. They probably also are present in the Paint Rock River, based on a credible report from Matt in Maryland. None of this is surprising that they're present in these northern tributaries to the Tennessee River, it's only surprising that what is probably a common species in these places has gone unreported for so long. But, that's the state of ecological work in Alabama, it's a very rich area for biodiversity but is still surprisingly unexplored.

A Push For Silver Shiners, And Telogia Fundulus DNA Too

2011-07-09T09:31:00.001-07:00

I'm going back to the Flint Tuesday afternoon with the Ichthyology class to look for Silver Shiners. We'll take my old 20-foot seine with relatively coarse mesh, and work the flowing pool below the riffle system. The river is fairly low even with rain yesterday so I hope it won't be an heroic effort to find more silvers. We'll probably find something else new to me in the Flint too, at the rate we're going.

I'm ready to start extracting DNA from the Telogia Fundulus fish Charlie and Tony sent me from the Florida panhandle. I have a total of 52 of these fish from 10 or 11 sites, and an extraction kit good for 50, so I'll use most of the kit. I have to keep a few as untouched vouchers. I think the protocols I've worked out with IExpression Genetics for PCR and sequencing will work, I hope to know fairly soon.

Thoughts About The Flint

2011-07-03T15:17:00.001-07:00

First off, a photo of the Flint last Friday. Two rainstorms in the previous 10 days did a pretty good job of scouring out the obnoxious green algae bloom that we saw at the time.

As to thoughts, I got a second opinion from Dave Neely that the silver shiners we caught there were, indeed, silver shiners. That leads me to think it's worth pursuing their status in the Flint, since this is a new record and is pretty much the southern edge of their range. The state of Alabama rates the species as Low Conservation Concern (which means they should be monitored, as opposed to there is no reason for concern), while the NatureServe system lists the species as S1, Critically Imperiled, in the state. I've also heard a credible report that the species has been seen in the Paint Rock, so that would be good to follow up too.

On Friday we netted large numbers of juvenile blotched chub, Erimystax insignis, along with more adults that we've seen before. This is another species at the southern edge of its range, and is also rated as Low Conservation Concern by Alabama but as S3, Vulnerable, by NatureServe. The fact that there seems to be a healthy breeding population at our site makes me think that this species is worthy of more study in the Flint, too. For these studies all I have to do is to find a student or two willing to help, and see what we find. We'll see...

Fun In The Flint

2011-07-02T07:57:00.001-07:00

We ran driftnets in the Flint yesterday since it was the new moon. We also did a lot of seining, looking for black and banded darters for Kara's project. Strangely we found almost no bandeds, although the blacks were easy. Above is a big hogsucker we netted, he was so pale when we netted him I thought he was a white sucker at first. He was released after photographing him. We also netted a big gar, spotted I think, and could have netted another two gars. That's a first for us at the Flint!

Back To The Flint On Friday

2011-06-29T14:12:00.000-07:00

This Friday is the next new moon, so we'll be back at the Flint in the morning to run driftnets. We'll also net more darters for Kara's project. She looked at about 20 each banded and black darters from June, and found very few gill parasites, slightly more in the bandeds. These are the two most common darter species at this site on the Flint, and it's reinforcing my growing conviction that the most common darter species in local streams will have fewer gill parasites than rarer species. This is certainly the case in Estill Fork, where the very common Tennessee snubnoses have very few parasites while the less common rainbows, fantails, stripetails and redlines have a lot more parasites.

I'm also curious to seine in the Flint in the deeper flowing pool below the riffles we usually sample to look for more silver shiners. The species prefers such areas below riffles, so hopefully we can find more of this species in this area. The Ichthyology class might go back and look for this too, in two weeks.

Apparently A New Species Record In The Flint River

2011-06-22T05:16:00.001-07:00

I took the Ichthyology class out to the Flint River yesterday to sample fishes. We found two species that I've never seen there before. One, the Bigeye Chub, is not a big surprise to find there. The other, which is still only a tentative ID, is the Silver Shiner, Notropis photogenis. Silver Shiners are fairly common just north of here in Tennessee but there are few recent records of them in the northern tributaries to the Tennessee River, mostly from Shoal Creek. Yesterday we netted four of these fish in the Flint. It's possible that they're Emerald Shiners. I'm going to send two of them to Dave Neely for a second ID opinion. There is no record of the species in the Flint, so that would be an interesting range extension. The picture below is big, so it can be easily enlarge for a closer look.

Rainy Day At The Flint

2011-06-19T13:42:00.000-07:00

We went out Friday morning to do transects at the Flint River site. The river was way low, and we worked in intermittent rain with thunder rolling to our south. We found fewer darters than usual, even with low water, because much of the riffle site is now covered with thick wads of green filamentous algae. My working theory is that this stuff blocks water flow at the bottom of the stream, where darters live and catch food, and the fish leave rather than hang around with this obstruction. The stuff is disgusting. We found the species pretty well separated from each other: the black snubnoses were in shallow, slightly flowing water and in some of the emergent vegation; stripetails were pretty much in that niche, and somewhat out in deeper water; bandeds were in their typical midstream fast water sites; and redlines were largely absent from the main channel, but were very common in an isolated side channel with fast shallow water over cobble and boulder substrate. This time we netted no rainbows or greensides, which was odd. I'm also confident now that the occasional Cyprinella shiners we net are Spotfin Shiners, not really a surprise. In the picture below are Eric, Brian and Alex as we prepare to hit the water. You can see some of the algae crud as streaks in the center of the river.

I Finally Have Fundulus DNA Sequences

2011-06-16T19:42:00.000-07:00

I just heard from Lance at IXG, of the five DNA extractions I gave him last week he got good sequences on four of them. This is a major break since the Omega extraction kit we've started to use apparently works really well. Each sequence is about 375 base pairs from the cytochrome-b mitochondrial gene, with forward and backward readings along the same stretch. IXG only used the amplifying primer for the sequencing, so we should be able to get the whole gene of 1140 base pairs using several other sequencing primers. The fish that we used are a Fundulus majalis from Charleston, SC, and some F. heteroclitus and F. diaphanus from the MA/RI coast that Tony sent me.

All I can say is, praise Jah it worked!

Things Are Happening, Really!

2011-06-15T17:58:00.000-07:00

I haven't written for a week out of sheer procrastination. One fun thing lately is I received 100 g of Damar Gum, a key component of making archival wholemount slides. Hopefully we can get a really good series of dactylogyrids found in darter gills. Kara made a good one over the weekend using Kleermount, which is a synthetic form of Damar but not really archival. She successfully transferred one worm from the gills of a stripetail darter. She had a lesson today on using the confocal microscope, and used this slide to learn how to capture images. Connie, the tech, was impressed by the images so I guess they're good(!). Luckily for Kara she worked with Connie just in time, Connie starts maternity leave tomorrow for obvious reasons.

We're going out to the Flint Friday morning to do transects for Brian's project. The river is REALLY low right, since we haven't had rain for about three weeks. I think this means we can easily do our fourth transect just below the bridge, through a fast deep hole frequented by big greenside darters. We should have a large crew of people show up to help, so it should be easier in general.

Ichthyology Class Visit To Estill Fork

2011-06-07T19:05:00.000-07:00

I'm teaching Ichthyology for the first time this summer as an all-day Tuesday class with a lab section. Today we did the first field trip, to Estill Fork in the upper Paint Rock River system at the Baptist Church site. In two hours of seining we found most of the species I'd expect to see with the odd exception of rainbow darters; we even netted a huge greenside darter and several blueside darters, along with hogsuckers that deeply impressed the students. Here's a quick shot of most of the class:

Forever Wild Reauthorized By Alabama House

2011-06-03T06:03:00.000-07:00

The Alabama House has overwhelmingly approved reauthorization of the Forever Wild program, with 79 yes votes. This means the program will be on the ballot in November 2012 for the voters to approve as a constitutional amendment. The program makes money available to buy and maintain property to maintain them as public access lands in perpetuity. The program was first authorized years ago, and has to be reauthorized every 20 years. It's been a huge success, in a state that has relatively little public land. These lands are variously open to hunting, fishing, and hiking uses. To me, the Walls of Jericho property in the upper Paint Rock River valley in Jackson County is the most amazing of these properties, but there is an increasing number of interesting properties around the state.

Back In Gear, Back In 'Bama

2011-05-26T18:03:00.001-07:00

I'm back from two weeks in Panama. Hopefully my export permit will be approved by the end of the summer so that colleagues at the Smithsonian can mail me my fish... I found 3 species of Brachyrhaphis where I only expected to find one, so this work could be even more interesting than I'd thought. I'll keep you posted.

A new student, Kara, has agreed to look at black snubnose darters for gill parasites. We'll get the darters from the Flint River where we're doing other projects. I'm curious to see if they have a similar low level of incidence as Tennessee snubnoses from Estill Fork. This will be a good complement to Robert's work I hope.

I also received a box from Charlie Nunziata with Fundulus that he and others collected at ~12 sites in the Florida panhandle. Hopefully DNA sequencing will show whether some of these populations are a new species, or (just) an interesting intergrade between F. notti to the west and F. lineolatus to the east, both members of the subgenus Zygonectes. I have all of them jarred in 95% ethanol until I get the right DNA extraction kit. Hopefully this goes easy...

Tracking Down Brachyrhaphis At Several Sites

2011-05-20T18:43:00.000-07:00

Today we did our last collection of Brachyrhaphis, at Quebrada Sardinilla in an easily accessible part of Soberania National Park. This site, Sendero El Charco, is described as a picnic area, which is true, but it's also an "Introduction to the Rain Forest" with an annotated loop trail. This crosses the creek at several points, with the picnic area at a small waterfall. We went to the furthest point of the loop trail where it crosses the creek with a suspended bridge. As usual, most of the Brachys I caught were in a small tributary in shallow, leafy water. Below is a picture of me basking in the relative ease of capturing fish at this site.

Yesterday we went to El Valle de Anton, in the floor of a drop-dead beautiful ancient volcano caldera about two hours west of Panama City. We collected fish at one site above a waterfall in Rio Guaybo to the northwest of town at about 650 meters elevation, and at a site to the northeast of town at 705 meters elevation. I mention the elevation because both are as high or higher than anywhere in Alabama... The first site is a tourist attraction with hiking on the grounds, and a zipline allowing people to roll down a suspended rope at the height of the forest canopy. That would be fun, but we didn't hang around to do it. The photo below is of me at the second site, Rio Mata Ahogado, chasing Brachys in the shallow sandy stream. The local people were politely bemused; rural Panamanians, especially, are very polite and tolerant, so crazy gringos showing up in the stream by the road netting fish wasn't a big deal.

First Day Out Collecting In Panama

2011-05-18T18:11:00.001-07:00

Ruth and I went out to three streams today with Gisela from the Smithsonian Marine Lab on Naos Island. She was able to borrow a 4WD truck from the Smithsonian, and the key to the famous Pipeline Road in Soberania National Park on the east side of the Panama Canal. It hasn't rained for several days which was good because that road would be impassable with any amount of rain. We collected ~40 Brachyrhaphis episcopi at Rio Macho and R. Mendoza, and ~40 of the closely related B. cascajalensis at R. Frijolito. It was hard work climbing down the surprisingly high banks at each creek's bridge, and wading down the creek using a Perfect Dipnet from Jonah's Aquarium to catch the fish. Both species are small livebearers, looking like Gambusia from North America but with some color. I put about 12 fish from each site in ethanol for possible future DNA work on host and parsites, and the remaining fish in fairly dilute formaldehyde to fix any parasites and the hosts too.

The following photo shows me and Gisela looking a net contents at Rio Macho.

Fun In Panama

2011-05-13T17:22:00.000-07:00

We met Gisela yesterday at the Smithsonian Marine Research Labs complex on Naos Island, at the mouth of the Panama Canal. She's a research staff member who supervises and maintains the freshwater fish collection there, which is pretty intense: one small part of it is an entire wall, floor to ceiling, of shelves with preserved characins, tetras, etc., most of which I'd never heard of. She has also done some work with various Brachyrhaphis species, which is of course what drew us down here. She offered, and we accepted, to visit the most inaccessible part of the Soberania National Park next Tuesday to visit several streams to collect Brachyrhaphis. This involves borrowing a 4WD vehicle from the Smithsonian, and also getting the Smithsonian's key to the gate at the beginning of the famous Pipeline Road into this area. There are 3 streams that I want to visit there, the Rio Macho, Rio Frijoles, and Quebrada Juan Grande. The rainy season has begun here, with daily rain, but for the entire day, just a shower now and then. Even so I suspect it will be an amazingly muddy trip.

A Driftnet In The Flint

2011-05-08T18:21:00.000-07:00

I went driftnetting yesterday on the Flint with Doug and Alex. The water was relatively high but manageable for one net anyway; a second in the spot we prefer would have been a serious wrestling bout. The flow meter measured the bottom flow at 380 turns/60 seconds (~0.4 m/sec), the depth at the spot was 55 cm, and the water was 16 deg. C. The river had been much higher and violent last Wednesday when I went there, to the point that we couldn't have safely set even the one net. A bunch of new large trees (including rootballs) are now strewn along the banks after the storms of the past 2 weeks. The river substrate is very well scoured after a series of violent events. Hopefully the fish liked all the excitement!

Estill Fork Pictures

2011-05-02T17:50:00.001-07:00

We easily caught our target of about 25 each of the darters of interest. Here's a view of the tools of the trade after we've put away the fish.

Everyone stands in the old ford, with the bridge in the background. If you look in the upper right of the photo you can see the high water wrack line from recent floods; at least one of them almost reached the bottom of the bridge. The stream was still moving pretty fast yesterday.

This is the Baptist church seen from the bottom of the ford road. They were holding service as we pulled up, playing piano and singing.

I Know Where To Find Blueside Darters

2011-05-02T10:50:00.001-07:00

Well, so do other people. But we netted a surprising number of Bluesides yesterday in Estill Fork, more than I've seen before. We're not using them in our current study of darter parasites, and so we were keeping Tennessee Snubnoses, Fantails, Stripetails, Rainbows and Redlines. The Baptist Church site has fast-flowing water over sand and gravel which of course is exactly what the species likes. It's a Tennessee River endemic, and Alabama is where the species is hanging on especially in the Paint Rock River system, and Little Bear Creek in Franklin County. It's biology hasn't been closely studied, so that's something we should maybe do in the near future.

Our power is coming back on in Huntsville this morning, luckily. We were sneaking in and out of the Shelby Center yesterday to pick up and return equipment for our Estill Fork trip. There's one major weakness in the electronic door security system, and lucky for me it's still a weakness so I can get in easily. Hopefully others don't know about it...

We Survived

2011-04-30T11:35:00.000-07:00

I survived the storms on Wednesday, we just have no electricity... We're going out to Estill Fork tomorrow, Sunday, meeting at UAH at 10 for Robert's last darter collection. See you then?

There Are Always New Species At The Flint...

2011-04-25T21:36:00.000-07:00

And today we saw two, the whitetail shiner and the dusky darter. When I first saw the dusky I was convinced it was a blotchside logperch. But when I got back to my office and looked at the pictures I realized it didn't have the long snout of a logperch; I was fixated on the blotches. So, after 7 months at this location we found our first dusky darter, Percina maculata. It's a fairly widespread species, but seems to be uncommon in rivers on the north side of the Tennessee. Now we can say that it is indeed found in the Flint River east of Huntsville. Here are the two best pictures:

Out To The Flint This Morning

2011-04-25T05:48:00.000-07:00

We're out today to do darter transects at the Flint. I've been watching water levels and volume drop on the USGS site for the Flint since Thursday. Strong rains will likely move into the area tomorrow afternoon, so today is our window for getting out safely and easily. It's warm enough that we can wade without waders, even better!

Forever Wild Closer To Reauthorization

2011-04-21T15:17:00.001-07:00

I'm reposting this from Conservation Alabama:

One last hurdle remains for reauthorization of Forever Wild. This morning, HB126 passed the Senate Energy and Natural Resources 6-3, setting up a difficult fight on the Senate floor that could come as early as next week.

Your hard work thus far to get Forever Wild renewed for 20 more years has been tremendous. But we can't stop now. Votes are tight in the Senate, and we need you to personally call or visit your state Senator today to ensure she or he will vote YES on HB126. Watch for action alert e-mails to help get Forever Wild through the Senate.

We are almost there! Together we can ensure our children and grandchildren will be able to enjoy Alabama's most precious places for decades to come.

Sincerely,

Adam R. Snyder
Executive Director

Shots For Panama

2011-04-20T15:20:00.000-07:00

I got two vaccines for Panama today, typhoid and hepatitis A. Since I'm not going to the eastern part of the country near the Colombian border I shouldn't need either malaria or yellow fever shots. I'd love to see that area, Darien, but it's a little wild and lawless for my immediate needs. Hanging out with Colombian FARC guerrillas doing their R&R in that region is not what I need at the moment.

Someone wrote an unusually stupid letter to the editor at the Huntsville Times a few days ago. She objected to the recent cover story about efforts to preserve the Spring Pygmy Sunfish, saying that any resources used in that effort should instead be used to stop abortion(!). I don't have much use for right-to-lifers under the best of circumstances, but this takes the cake for d-u-m dumb.

Perfect Dipnet From Jonah's Aquarium

2011-04-14T18:32:00.000-07:00

I received my Perfect Dipnet from Jonah's Aquarium. I've never owned one, but I've seen them used by others. For my purposes in Panama the net should work, since it's collapsible for portability on a jet, but robust enough to put up with a lot of abuse. Thanks Mark!

A Postcard From The U.S. Fish and Wildlife Service

2011-04-08T09:56:00.000-07:00

I just received a postcard from the U.S. Fish and Wildlife Service about the status of the Spring Pygmy Sunfish. The first sentence reads:

"On April 1, 2011, the U.S. Fish and Wildlife Service will publish an announcement, in the Federal Register, of a positive 90-day finding on a petition to list the spring pygmy sunfish as endangered under the Endangered Species Act (Act)". The link to this is http://www.federalregister.gov/agencies/fish-and-wildlife-service#recent_articles, and scroll down to April 1.

You can look for Docket Number FWS-R4-ES-2010-0007 for specific information being handled by the office of the FWS in Jackson, Mississippi.

So I guess the spring pygmy will really be listed as Endangered, once and for all. I hope that this will really help the species, which of course needs all the help it can get.

Flash! Fish & Wildlife Might List The Spring Pygmy Sunfish!

2011-04-05T17:37:00.000-07:00

Check out the link below:
http://www.fws.gov/southeast/news/2011/11-031.html
It looks like the U.S. Fish and Wildlife Service is changing its mind about listing the Spring Pygmy Sunfish under the Endangered Species Act. The Center for Biological Diversity and Mike Sandel, petitioners for the listing, are rewarded for pursuing the FWS in a fairly aggressive fashion (like filing a Notice of Intent to file a lawsuit). I'm congratulating myself for writing a letter in support of an emergency listing of the species, and I'm glad that NANFA, North American Native Fishes Association, also wrote a letter in support of the petition. I also heard today from a Huntsville Times reporter that one or more of the local landowners around the Pygmy's spring system are negotiating with FWS to protect the species in a meaningful fashion.

A summary of all of this appeared as the lead front page story in today's Huntsville Times, at http://blog.al.com/breaking/2011/04/feds_may_protect_rare_sunfish.html.

High Water At The Flint, Again, For Driftnetting

2011-04-02T17:42:00.000-07:00

The new moon is tomorrow, so we went out today to driftnet at our site on the Flint River. It was a mild, sunny day after a week of dank rain off and on. Because of recent rains the river was at the highest level we've done yet, so that we only set one net for reasons of safety and not having to walk out into the most treacherous part of the stream. Below is a view of the net, with 4 of us holding on to it. By the end of the hour one of the pole sleeves was mostly torn out, and a small hole had appeared in the bag of the net. But then, water velocity 6 cm off the bottom was 0.8 m/sec so we were running a form of stress test.

Water temperature was 11 deg. C, while air temp. was 10 deg. C when we started. Here's a shot of Doug with the bridge to his front. If you look closely in front of Doug's mouth, one of the bridge supports has a huge tree wedged against it. We had a plan to retreat quickly if it came loose and rolled towards us. Luckily, it didn't.

New Net From Jonahs Aquarium

2011-03-29T09:41:00.000-07:00

I ordered one of Jonah's Perfect Dipnets yesterday for use in Panama. These nets are almost indestructible, and have collapsing handles which is good for international air transit. The total cost is $80 but for my purposes that's almost cheap. I'll be chasing Brachyraphis episcopi around in streams, and they usually hang out in shallow water along the bank so I don't think a seine net is necessary to capture them.

Locally, we hope to get out to the Flint River this Saturday morning for driftnetting. The river level will hopefully be down after the rains over the weekend, and weather is predicted to be sunny and in the 70s.

And, Estill Fork Is Changing

2011-03-22T16:38:00.000-07:00

The picture shows a sizable landslide just downstream from our sampling site at Estill Fork. The bank there is pretty steep and rises to the road, which is heavily engineered to fit on the side of a mountain. A large gouge of soil, gravel fill and small boulders slumped from under the road way and carved a shallow gully into the hillside ending at the stream. It has the interesting effect of extending our riffle study area because it juts out fairly fair into the stream, creating a narrows with faster water downstream for about 40 meters before ending at a deep pool. There is evidence that the water may have been as much 3 meters higher last week after the heavy rains, which of course weakened the structure of the roadbed and the hillside below. Next time we drive in on the other road!

A Beautiful Day To Go To Estill Fork

2011-03-21T17:29:00.000-07:00

We spent most of the day at Estill Fork in NE Alabama doing field work for Brian's transect research. The weather was mostly sunny, and in the 70s F. The darters were all in color today, including rainbows, tennessee snubnoses, fantails, stripetails, johnnys, redlines, greensides and the next two species:

These are two blueside darters, male and female. We usually only net a few on these trips, but today we found about a dozen. Males retain some of that electric blue year-round but it's certainly peaking now.

We found a male and an even larger female blotchside darter. This is the male in a storage bag. He was released about two minutes later. It's a species that should probably be listed as Threatened under the Endangered Species Act.

Here's the crew soon after arrival: Alex, Brian's brother, Brian, Robert and Doug (l-r). Water temp was 14 deg. C, so some of us waded without waders.

The banks on both sides of the stream had patches of Virginia Bluebells in flower. The wildflower season has just started. What's impressive about the Bluebells being in bloom is that Estill Fork had a major flood last week that obviously scoured the banks heavily. I guess the plants like that kind of high energy.

Tickets To Panama, Finally

2011-03-18T18:45:00.000-07:00

This has been a distracting week, but it's spring break next week so everyone can sober up and take a deep breath. I was finally able to buy tickets to Panama for Ruth and me yesterday, through Orbitz. We even got a surprisingly good price, for which I'm grateful. My Spanish phrase of the day is, que asco, which means "that's disgusting". Hopefully I won't have to use it. Yesterday's (fragmentary) phrase was, mas cerca, or closer.

We're going to Estill Fork on Monday to do transects for Brian, and to collect darters for Robert. The weather should be sunny and in the 70s, so we can't complain about that. The darters should really be peaking in color.

We Missed The Rain, And Interesting Dactylogyrids

2011-03-12T13:46:00.000-08:00

It's been a very busy week, I've spent a strange amount of time working on our department's search for three new faculty. As usual, this involves a variety of totally unexpected twists and turns. But, I'll have to tell you later. Also, it rained almost six inches this week, so we were lucky to get out to the Flint last Friday; the river has been at flood stage much of the past week.

We had a lab meeting yesterday, and Robert talked about his work with the darters and parasites. He showed some really good digital photos he has at various magnifications of these parasites, and for the first time I fully realize that they're different from the Dactylogyrus we found on the telescope shiners. The posterior end with the haptor hooks is much more flared in the darter parasites, and we probably have several different species that have to be sorted out on the various darter species. So it's good, we have something.

An Easy Driftnetting At The Flint, And Alabama Imperiled Fishes

2011-03-05T12:08:00.001-08:00

We went out to the Flint yesterday since it's the new moon, so time to driftnet. The original plan was to go out today, but there was a big threat of rain (it's raining now) and also the river was probably lower than last Saturday with no rain in-between. It was a mild day, and the river was indeed about 6 inches lower than last Saturday which made moving around much easier. We were able to set up both nets in the places that we usually put them. The first picture is my standard view towards the bridge, showing lower water level.

Alex and Doug are carefully picking their way back across the river with the net from our "station B" on the far side of the river.

Jeremy and Brian compare strange wader tricks as we prepare to leave for the day.

Alex, Jeremy and Doug wash out a net, trying to flush out trapped drifting animals into a peanut butter jar using as little water as possible. If done right, it's kind of like having concentrated Flint River water.

Also, Brian and I went to the Alabama Imperiled Fishes meeting at Lake Guntersville State Park on Wednesday, hosted by Steve Rider of the state DCNR. 20-plus people were there, sharing experiences and thoughts about various vulnerable species in the state. Bernie Kuhajda from Tuscaloosa talked about his findings with the newly-rediscovered trispot darter, which are very different than what has been found with the Tuscumbia darter - both are spring run species, but the trispots vary genetically from stream to stream while the Tuscumbias vary little across their range. Mike Sandel, also from Tuscumbia, talked about the Alabama pygmy sunfish that faces multiple threats as the city of Huntsville expands to the west into its spring habitat. The species seems to be stable in three of its springs, and in trouble at the other eight or so springs that make up this ecosystem, due to human land uses. Various speakers spoke about finding more Cahaba shiners in various parts of the Cahaba River system than might have been feared, given that the species is listed as Threatened under the ESA. The meeting is an informal way to hear and share about species facing threats in the state, and what is being done to help them and study them. It may be combined next January with similar meetings that have been held for crayfish and mollusks, kind of a one-stop solution since many of the same people attend these meetings.

Also On Saturday At The Flint

2011-02-28T05:34:00.000-08:00

I forgot to mention in yesterday's post that we netted 7 or 8 blotched chubs, Erimystax insignis, while looking for darters. We found them along the west bank, about 5 meters from the shore, in shallow, fast water, but not too fast. This species is ranked as S2, Imperiled, in Alabama since it's only found in parts of the Flint, Paint Rock and Shoal Creek. It's patchily common up in to east Tennessee and southwest Virginia with an overall ranking of G4, Apparently Stable, from the NatureServe site. Several of the individuals we saw were obviously gravid females, so they seem to belong to a healthy local population. It's another species worthy of more research into their current status, along with their general biology.

The Heavy Lifting: Estill Fork On Friday, Flint On Saturday

2011-02-27T18:14:00.001-08:00

We went out to Estill Fork on Friday afternoon to collect darters for Robert's project, and to the Flint River on Saturday to do the transect work for Brian's project. Both rivers were fairly high, not too high but high enough so that pulling a seine net was a challenge at both. The first photo is of Robert and Jeremy walking downstream at the end of our collection at Estill Fork, the "Baptist Church" site.

The darters are in breeding coloration now, since it's really early spring. We netted several large, colored up male greenside darters including the one below. We also caught some of the biggest sculpins I've seen in local streams.

We had beautiful weather at the Flint on Saturday, with the water level just within the limit we can work in. It's the closest I've been to having a seine net pulled out of my hands, with the complication of uncertain footing. Luckily we got out intact, although Alex halfway slipped in before recovering. The photo is of Brian as we prepared to leave.

And in another hand-held shot, here's one of the electric male banded darters we caught. They always have a distinctive emerald green banding pattern, now it's strongly enhanced.

Brittany Passed Her Thesis Defense

2011-02-24T07:32:00.001-08:00

Brittany did an excellent job yesterday presenting her research project, "Invertebrate Drift in Estill Fork, Jackson County, Alabama." She'll have to do some editing and reworking of some of her thesis, but she should be able to do that in the allotted time and graduate in May.

Weather permitting, we're going out to Estill Fork tomorrow afternoon to get darters for Richard, and on Saturday go to the Flint to do the transects and darter netting. The Flint has been reasonably low this week, I hope we don't get lots of rain tonight because that might make us cancel if the river rises. We'll see...

Support The Reauthorization Of Forever Wild

2011-02-22T07:16:00.001-08:00

Everyone who lives in Alabama should contact their state legislators and ask them to support the reauthorization of the Forever Wild program in Alabama, which expires via sunset next year. This program enables the state to spend money from non-tax sources to buy and maintain parcels of land for public use. Over the 20 years the program has been in place, ~200,000 acres of land have been purchased. My favorite state land tract, the Walls of Jericho, is one of the more recent of these purchases now with about 9,000 acres which largely protects the upper Paint Rock River drainage in Jackson County. For more information about this reauthorization campaign visit Conservation Alabama, at www.conservationalabama.

So, On To American Midland Naturalist

2011-02-17T14:29:00.000-08:00

I just submitted our manuscript, "Investigation of the Relationship Between the Steroid Hormone 11-Ketotestosterone and Reproductive Status in the Fish Lythrurus fasciolaris", to the venerable journal American Midland Naturalist. I was happy working with them on the telescope shiner article that was published last April, so hopefully they'll like this one too.

Anyone in the Huntsville, AL, area should drop by the Shelby Center at UAH next Wednesday, Feb. 23, at 2 for Brittany's defense of her thesis, "Invertebrate Drift in Estill Fork, Jackson County, Alabama" in SC 216. She'll do about a 45 minute presentation on her work, and then the committee will decide if we approve and sign off on her to receive a Master's degree. Her thesis is already in good shape, so that should be easy in this case.

No Luck With Behavioural Brain Research

2011-02-12T09:56:00.000-08:00

Our 11-KT in scarlet shiners manuscript was quickly rejected at BBR, as something outside their current topics of interest. It was admirably fast; I submitted the material through their electronic portal first thing in the morning, and heard back from them about 4 that afternoon. My cynical thought is they're not interested in anything not done on rats or mice, but what the hell, that's their loss. Anyway, I'm reformatting the manuscript to submit to American Midland Naturalist. The truth might be that the work we're doing is of most interest to people doing "natural history", which self-identification seems to be making a big comeback. I'll just stay away from snide British editors of upscale biomedical journals, which should have been self-evident.

My Visit To The Smithsonian In Panama Has Been Approved

2011-02-11T14:19:00.001-08:00

So, now I have to figure out how to buy tickets to go to Panama in May using University money, and also use our own money to buy Ruth tickets to go with me at the same time. The one last detail is filing my terrestrial collecting permit through STRI so that I have government permission to run around and catch Brachyraphis episcopi hither and yon. It's all in Spanish, and luckily Ana helped me this afternoon with my CV and the form itself. One question asked if my collecting would damage the environment or cultural artifacts, and my initial answer was, "Que yo sepa no", not that I know of. She suggested I just put down "ninguno", none, as a simpler, more direct answer. I'm learning... ask me to conjugate the verb ir!

11-KT In Scarlet Shiners Manuscript Submitted

2011-02-09T07:48:00.000-08:00

I just finished submitting the manuscript about blood plasma levels of the steroid hormone 11-KT in scarlet shiners to the journal Behavioural Brain Research, part of the Elsevier publishing empire. They have an elaborate online submission system that always takes about an hour to fully understand if you haven't fooled with it lately. But, it's all submitted, and I hope they like our story. The title and authors:

"Investigation of the Relationship Between the Steroid Hormone 11-Ketotestosterone and Reproductive Status in the Fish Lythrurus fasciolaris."
by Jennifer Schade and Bruce Stallsmith

Driftnetting At The Flint On Friday, Feb. 4

2011-02-06T09:29:00.001-08:00

Friday was a threatening day, with the local weather people besides themselves talking about threats of ice, snow, horrible rain, etc. But luckily for us they were largely wrong. By the time we went out to our regular driftnetting site on the Flint in the afternoon there was a light, irregular spitting of rain, and air temperature was about 40 deg. F, with no wind. So standing out in the middle of the river for a little over an hour wasn't too horrible. And the river was maybe 15 cm lower than our last netting, so we were able to set up both nets in the places we've used before. The surface water flow was about 1 meter/second, at 6 cm off the bottom it was about 0.5 m/sec, and water temperature was 6 deg. C. Footing was tricky in the main current, but no one fell, although Doug had a close call. The following photos document the basic work, starting with a shot of the older net being held stably within Robert's PVC frame along with the zinc dowels.

Here's my de rigeur photo of the Winchester Road bridge looking upstream. You can see the low rock formation rising up in front of the bridge just to the right of the photo's center. As long as we can see most of that rock peak, the river is workable. We also watched as deputies chased down some people who ran into their speed trap to the left of this view, on the west bank of the river.

Robert and Doug are able to chat while holding a net in place. Ruth repaired the newer net they're using, and it held up in the deeper, faster site with Robert and Doug's help. Both nets had a fine patina on their exposed surface from entrained clay silt in the river, which was more turbid than usual after recent storms.

2011-02-05T14:20:00.000-08:00

Thanks to Ana at UAH, I have my plan of study in Panama translated to Spanish so that I can apply for an export permit to leave that country with pickled fish. And the permit has to be filled out in Spanish... so here's the last paragraph, broadly describing what I want to do in Panama:

ACTIVIDADES PLANEADAS DURANTE MI ESTADÍA EN EL STRI:

Yo tengo planeado estar en el STRI por dos semanas durante el mes de Mayo del 2011. El proyecto estará basado en Ancón, en el Centro de Investigación Earl S. Tuppér. Además de conocer el STRI y su equipo de investigadores, la mayor parte de mi trabajo será el visitar los doce sitios en los que Jennions y Kelly (2002) colectaron sus especímenes de B. episcopi, para lo cual contamos con las respectivas coordinadas de GPS. Diez de los sitios están ubicados en el Parque Nacional Soberanía, y los otros dos en los rios Antón y Ahogado, aproximadamente 60 km al sudoeste de Ancón. Todos los peces colectados seran fijados en formaldehido. Durante nuestra estadía en Panamá llevaremos a cabo trabajos preliminares en algunos de los especímenes para detectar presencia de tremátodes. La mayor parte de los exámenes de parásitos y los estudios de las condiciones reproductivas de los peces colectados serán realizados en la Universidad de Alabama en Huntsville.

New Waders, And Scarlet Shiners 11-KT Abstract

2011-02-02T11:43:00.000-08:00

I received my new waders today, shipped from my number one fashion suppliers at Forestry Suppliers in Jackson, Mississippi. We'll probably go out to the Flint on Friday so I'll definitely use them there. These are much more insulated with Thinsulate than my last ones, so that will be good come Friday.

The manuscript drawn from Jennifer's master's thesis is just about ready to go, 24 pages including figures and tables. Here's the abstract from the work:

In teleost fishes, 11-ketotestosterone (11KT) is a critical androgen regulating primary and secondary sex characteristics. In the sexually dimorphic Lythrurus fasciolaris (Cyprinidae), dominant nuptial males display heavy tuberculation on the head and nape, dark dorsolateral vertical bars, and dramatic red coloration in the fins, venter, and operculum area. This study aimed to quantify 11KT circulating levels in males and females, and determine any correlation with key male reproductive status indicators such as nuptial coloration, size, and gonadosomatic index (GSI). Thirty-one wild-caught L. fasciolaris were divided into three groups according to reproductive status: dominant males (D), non-dominant males (ND) and females (F). Physical measurements, digital imaging, and blood samples were used to quantify body size, GSI, nuptial coloration, and 11KT circulating levels. Dominant males had higher 11KT levels and nuptial coloration traits compared to ND males and females (red area, hue, saturation), and a higher GSI than ND males. Non-dominant males had more 11KT and coloration than females. Increased 11KT levels corresponded to increased coloration, size and GSI.

Mummichog DNA Manuscript Accepted For Review By Northeastern Naturalist

2011-01-28T11:44:00.000-08:00

I just heard from the editor of the journal Northeastern Naturalist that the manuscript by Kris and me has been accepted for review, with a guest editor and 2 reviewers. That's usually a good sign, so I feel better already. I was afraid they might think the research was too molecular in nature.

The new moon is next Thursday, so we'll be going out on Friday afternoon to run drift nets on the Flint River. Ruth repaired the torn seam on the newer net using heavier thread and a better stitch pattern, so it should work. There's no significant rain between now and Friday, the river shouldn't be at a suicide commando level.

Looks Like It's On To Panama In May

2011-01-25T19:23:00.000-08:00

I heard from the Smithsonian Tropical Research Institute in Panama today. They've accepted my research proposal to check out Bishop's Livebearer for gill parasites. So, now I have to firm up the details like the exact dates, housing arrangements, lab access, hopefully using their 4WD vehicles for field work, ... Last week I started the process on campus of getting approvals to spend the money for travel. A whole string of people have to sign off and approve me using allocated money for travel. I don't think anyone has a problem with it, but universities are nothing if not bureaucratic.

I did the systematics exercise in Vertebrate Zoology today. Groups of students received 8 different fish species, and looking at various external physical traits had to create a character matrix and use it to construct a cladogram to represent similarity, and presumed common ancestry. I used some local species for it from our preserved fish collection, including stonerollers, scarlet shiners, bluegills, gar, paddlefish and sturgeon. The odd thought is that I'm the only one in our department who routinely does this kind of thing, a core part of describing and understanding biodiversity (one other faculty member at least touches on this). It's a fun exercise because there's no easy, obvious answer and everyone has to think about it. I pointed out to them that biology in particular, and science in general, is one long argument so they should certainly debate any presented outcomes.

Estill Fork, With Snow On The Ground!

2011-01-22T17:53:00.001-08:00

Well, not lots of snow, but I think it's the first time I've been there with any snow on the ground. Water temperature was 6 deg. C, and air temp was about 0 deg. C when we arrived. We went primarily to do the darter habitat partitioning survey work for Brian's thesis work, and also to get darters for Robert's darter gill parasite project. Six people went, which made it relatively easy, me, Brian, Robert, Doug, Jeremy and Heather. We found many more fish than on previous visits, largely because our take of rainbow darters was huge including many juveniles. Also, we found lots of both stripetail and fantail darters, including a large number of juveniles in a few locations in our transects. It was cold but not unbearably so. In the first picture below, Robert and Doug do their respective tasks of timekeeping and data recording while Brian is in the stream taking depth and current flow readings.

Here's my traditional shot looking across Estill Fork to the east from where we park. The stream was full today, unlike our last visit in November when it was in low flood.

Brian prepares for our first transect.

Brian doing a current flow reading, while Jeremy on the far shore pretends to hold the end of the survey tape. Notice how clear the water is around Brian, in a spot where the water is about 40 cm deep. That's the area where we found lots of juvenile stripetails, and to a lesser degree juvenile fantails; they were even more common about a meter closer to the near bank where the stream ran through a hole about 70 cm deep.

Mummichog Manuscript Submitted To Northeastern Naturalist

2011-01-16T16:08:00.000-08:00

I just submitted the manuscript, "Phylogeography of the Killifish Fundulus heteroclitus (Mummichog) Based on the Cytochrome b Gene", to the journal Northeastern Naturalist, authored by Kris Stanton and myself. Hopefully they'll like it, as long as they don't think it's too molecular for their focus. If so, well, we'll take it from there.

Sculpture Follow-Up

2011-01-13T09:35:00.000-08:00

I found out the artist and name of the "minnow trap" sculpture in front of the Shelby Center. The artist is Michael Cottrell from Jacksonville State College in Florida, and the sculpture is titled, "Valence". I wrote him and told my impressions, which I think favorably impressed him. His response to me is below:

"Bruce,
Thanks for your kind words. We thought the piece might be well suited to the science building, and I am glad that is indeed the case. I hadn't thought of minnow traps...but now that you mention it... Its good to see that the art can appeal to a diverse group, and it is perfectly normal to project a bit of yourself into what you see in an abstract sculpture.

If you are interested, the website for the sculpture tour which highlights all the pieces in the exhibition and their locations is:
http://www.spacessculpturetrail.org

Thanks, ----Michael"

Male Shiners May Have Relatively Larger Brains?

2011-01-11T16:26:00.000-08:00

I took the opportunity of a second snow day today to chug through some very detailed data we've generated about brain size in telescope shiners. Brittany, Alexandra, and I think Andrew measured the overall brain and the volume of individual brain structures from each of 10 male and female telescope shiners from each of April and June, the beginning and peak of their spawning season at Estill Fork. Looking at averages, and average ratios such as brain volume to standard length, I teased out some patterns. While female telescopes are longer and heavier on average with larger brains, in both months males had larger ratios of brain mass to net body weight (not counting gonadal mass), the volume of the optic tectum to total brain volume, and the ratio of optic tectum volume to standard length. These ratios weren't always statistically significantly different using a two-tailed t-test. We have found basically the same patterns with scarlet shiners. What's interesting is that the optic tectum is a relatively large part of the brain that processes visual information and helps the fish to move in three-dimensional space. As mammals we have them too, but they're much reduced.

The big question is, as always, what does it mean? I think it reflects the fact that male vertebrates have a much wider variation in reproductive success than females, and for stream fishes this is strongly linked to the ability to find and hold optimal position for spawning. Telescope shiners aren't strongly sexually dimorphic like scarlet shiners, and males don't guard territories to attract females. But males have to be able to show up in spawning aggregations and not be muscled out, which is largely an information processing exercise. My working hypothesis is that it's advantageous for males to have relatively larger brains, especially the optic tectum, as the result of long-term sexual selection pressures producing large-brained males. Does that mean they're smarter than females? Not exactly, but they may be more agile swimmers, which is a hard thing to quantify I suspect. Now I have to pull out our scarlet shiner data and look at it more closely, too, and try to mesh the two data sets together in a coherent fashion.

School actually starts tomorrow!

The Mummichog Manuscript Is Just About Ready To Go

2011-01-10T14:30:00.000-08:00

I took advantage of the snow day today to do a final round of polishing on the manuscript by Kris and me, "Phylogeography of the Killifish Fundulus heteroclitus (Mummichog) Based on the Cytochrome b Gene". One good sign is getting it down to 18 pages as I've slashed soft verbiage and redundancy. With any comments from Kris, and a last round of checking the format so that Northeastern Naturalist will like it, I'll send it out.

We got six inches of snow in Huntsville overnight, which is about as much as get in a typical year. Today was the scheduled first day of the spring semester, but that didn't happen as everything in town was shut (no snow plows!). I feel lucky that we were able to get out last week to do various stream work, ahead of what's likely to be this week's wintry weather.

Southeastern Naturalist Accepts Paper For Review

2011-01-07T13:16:00.001-08:00

I heard from Southeastern Naturalist today about the Dactylogyrus & Telescope Shiners paper. The editorial board has agreed to send it out for full review with an assigned guest editor and probably two reviewers. This is good, and usually means that they'll accept the paper as long as reviewers' comments are addressed. I hope so.

A High-Water Trip To The Flint Today

2011-01-04T19:34:00.000-08:00

It rained about 4 inches here on New Year's Eve into New Year's Day, and the rivers all flooded. Today we went out to the Flint River to run the driftnets, since it's the new moon. The water was higher than ever, but not quite too high. We tried to set a driftnet at one of our standard places, but the high, fast water quickly tore a side sleeve and it started to disintegrate. The water was probably moving almost a meter/second. The picture below shows Robert, Jeremy and Brian grabbing parts of it before it disappeared downstream.

So, we set the other driftnet in a quieter area that still had a current of about 0.4 meters/second, a pretty good pace. It still took three of us at a time to hold it in place. Below is a picture of the drift being transferred to a jar at the end of an hour. With six people taking turns, this wasn't so bad.

Fundulus heteroclitus paper almost ready to go

2011-01-03T11:48:00.000-08:00

I've been plugging away at editing Kris' thesis on cytochrome b mitochondrial DNA into journal format, and I think I'm almost there. Below is the current version of the Abstract.

ABSTRACT

The mitochondrial cytochrome b gene from seven populations of the killifish, Fundulus heteroclitus, was examined for single nucleotide polymorphisms and haplotypes. Three populations were from New England, two from Virginia, and one each from South Carolina and Georgia. In the gene sequence of 775 bases examined, 16 SNPs were found which defined an expected distinct northern haplotype. A Virginia haplotype defined by five SNPs was also found, separating them from populations further south. Phylogenetic analysis using Bayesian inference supports a north/south divide. The genetic distance between the three northern populations and the four southern populations was 1.5%. These findings support the hypothesis of post glacial rapid leptokurtic migration of F. heteroclitus to the north from southern refugia ~13,000 years ago. This caused a genetic blockade within the species, leading to the lower genetic diversity found in modern northern populations compared to southern populations.

A New Look At F. Similis And F. Majalis DNA

2010-12-29T18:26:00.000-08:00

I've been on a new burst of activity analyzing cytochrome b DNA sequences using the Geneious software package. I've realized that Bayesian inference, a somewhat quirky statistical method, is the best approach to comparing sequences of DNA and building a tree so as to easily visualize patterns of relatedness and divergence. The image above is a cleaned-up, simplified analysis of what I have to date in my quest for looking at the relatedness between two very similar coastal killifishes, Fundulus majalis and F. similis. The two fish at the top of the cladogram are related species present to serve as outgroups, for comparison purposes to "root" this analysis. The numbers at the nodes of the branches are consensus numbers, basically a measure of how strong the decision to put a branch at that spot on the tree is from running lots of replicates of the tree building algorithm.

The two species separate out cleanly in this tree, but there's not very much distance between them; the scale bar showing 0.03 (substitutions per base, really) is about how different they are, and that's not a big difference between species. The other interesting feature of this tree is that the Key West, Florida, F. similis is relatively removed from others of that species. There has been discussion over the years about whether the Key West population is really a separate species. I would say that it doesn't appear to be, but it does rate consideration as a distinct population about halfway to being a distinct species, with the other Florida group being close to it (I'm not sure where in Florida that's from, I downloaded that sequence from GenBank and it was only labeled Florida). I have a thought that because Florida has so much coastline that has been suitable habitat for a long period of time (even during the last glaciation) that Florida populations are more ancient and have had time to diversify. Conversely, F. majalis is only found on the Atlantic coast and has probably been affected by glacial cycles that greatly reduce available habitat, leading to lower genetic diversity as a result of long periods of reduced population. That's my working theory, anyway. I hope to have more DNA sequences in the not-so-distant future (thanks, Tony!) and see how this plays out with more localities.

Is This Really A Minnow Trap Sculpture?!?

2010-12-27T16:58:00.001-08:00

This sculpture appeared with no warning at the main entrance to the Shelby Center at UAH last week. I approve of public installation art, so that's cool. But what made me laugh are the cones sticking out from the piece. My first thought was, "My god, it's a minnow trap sculpture!" They're not exactly like minnow traps, of course, but close enough. How did they know? I'm honored.

Estill Fork For All The Darters We Could Catch

2010-12-23T15:45:00.001-08:00

We went out to Estill Fork at the Baptist Church site today to collect darters for Robert's gill parasite project. It was a cool, clear day, with a good solid water flow as you can see in the picture above. That view is pretty much the area we worked. We were interested in tennessee snubnose, rainbow, fantail, stripetail and redline darters, and kept a banded just as a voucher of sorts. To get the fantails and stripetails, we set the seine and kick and disturb rocks just upstream of it, since those two species more than others are hunkering down around rocks. And it worked well for us.
This spot used to be a ford across Estill Fork before the bridge was built, since it has exposed bedrock not always too deep. Above are Robert and Brian on the road leading into the ford from the east, with the baptist church behind them. Needless to say, this is an easy access point once you find it.
At the end of our trip Robert waded out into the pool at the ford to net a few more large stripetails, which was successful. Fantails and stripetails are pretty similar until you pick up the distinguishing traits, like stripetails have a dark submarginal band on the first dorsal that fantails don't, and the stripetails have some vertical banding on their sides while fantails typically have lateral lines of dots. We're interested in them because they seem to carry more parasites than the tennessee snubs in particular, which are the most common darter in this system.

The Flint River At Winchester, Now THAT'S A Riffle

2010-12-22T17:40:00.001-08:00

Five of us made it out to the Flint today to do our habitat survey and darter catch & release. The weather was almost mild at 50 deg. F, but with a steady north wind. The river was down from our last visit but water was still flowing fast. We caught a good number of fishes, especially banded, black and redline darters with a few rainbows and a single greenside. There was a very sharp distinction between where the bandeds and the blacks were found; if deeper, fast water over rock there were bandeds and some redlines, along the shore in less turbulent water were blacks and some redlines.

Here's our first transect line today, Jeremy and Robert on the left, Brian paying attention to the flow meter rod and Alex on the far distant shore. The river was about 38 m wide here.

Here are Robert, Jeremy and Brian carefully crossing the river at our fourth transect point, where the water is fast as it narrows down at the top of this riffle system. This was the most well-defined niche of all, with only bandeds and redlines in the area where everyone's walking, and blacks in the flooded grassy bank about 10 m behind them.
Another shot of the fourth transect, with the depth and flow measurements being made.
And, here's a view upstream from the first transect line to the bridge, with the fourth transect just this side of the bridge. If you look closely you can see whitecaps on the water surface showing breaking water in this riffle.

New Seine Is Ready To Go

2010-12-20T14:53:00.000-08:00

I received a new seine from Memphis Net & Twine last week. It's 12 feet long, with a 1/16" mesh on it. That's fine enough so that we'll net surprisingly small fish, which is the desired effect. It will also be harder to pull up in fast water; we'll see how bad that is. And that might be on Wednesday - we'll got out to the Flint River and do our flow/depth/darter habitat survey. It hasn't rained for a few days, and shouldn't too much between now and then. Hopefully it will almost be easy...

Black Darter Discussion, From Unpublished Manuscript

2010-12-17T13:59:00.000-08:00

This is a little odd, but I want to "publish" the Discussion from my manuscript on observing black darters, Etheostoma duryi, from two creeks near Huntsville, AL, several years ago. This is the manuscript that was accepted by Southeastern Naturalist but I had to withdraw it when the co-author disappeared with all of the original data so that I couldn't make modifications on our Results asked for by the editor. We collected and examined both male and female darters from two populations, preparing stained slides of cross-sections through their gonads to estimate size and describe reproductive status. Rachel, the other author, also counted eggs and described their developmental stage from female fish. Town Creek is in Athens, AL, and is an urban, somewhat eutrophic creek. Limestone Creek is in the NW corner of Madison County, AL, in a rural area with lower nutrient inputs. Nanostoma is the subgenus to which black darters belong. I'll omit listing References at the end of this blurb...

* * * * * * * * *

Two populations of Black Darter from nearby creeks did not significantly differ in reproductive investment or in reproductive output. There were, however, significant differences in the total oocyte complement between the sites, best attributable to significant body size differences. Town Creek females were larger, and had attained this larger size going into the breeding season. The month of capture had a significant effect, the site of capture had a highly significant effect and the sex of the fish had a highly significant effect on the mean standard length. Town Creek fish had a greater mean standard length than Limestone Creek fish, and males were longer than females. In darter species the males grow faster and larger than females, so this result was expected (Page 1983).

The observed increase in standard length of Limestone Creek females (but not of Town Creek females) may indicate that any significant growth at Town Creek had occurred prior to the beginning of the study and resulted in larger females. One key difference for Town Creek females was that as standard length increased, the GSI decreased. This indicates that larger females at Town Creek expend less energy toward reproductive investment and more toward physical growth than do smaller females. Fuller (1998) demonstrated that E. caeruleum females in Michigan have a similar relationship between body growth and reproductive development.

Heins et al. (1992) found significant differences between the mature (MA) oocyte weight and the ripening (MR) oocyte weight. If females from Limestone Creek were slow in maturing, they could just be beginning MR development, during which oocytes can have varying sizes. If most of the MR oocytes from Limestone Creek are in the early ripening stage and most of the MR oocytes from Town Creek are in the later ripening stage, the result could be a significant difference in total body weight. Furthermore, if more Town Creek females have ripe, hydrated eggs than do Limestone Creek females, then the water from hydration could increase the overall body weight.

As could have been predicted by the results regarding standard length and weight, there was a highly significant trend for a positive increase in the ratio of weight/standard length in females from Limestone Creek, but no such trend existed for Town Creek females. This suggests that some Town Creek females may have spawned some ripe eggs prior to capture, thereby conferring less of an increase in the ratio than seen in Limestone Creek females. For males, there were no significant trends in the mean ratio of weight/standard length over the three months studied. Males appear to be at their optimum condition in January, prior to any significant female development.

The two populations showed similar patterns in the development of reproductive phenotype, with Town Creek individuals tending to develop earlier. At Town Creek, females were gravid in the February capture. Male breeding coloration began to stand out during the same time period. Limestone Creek females were beginning to become gravid in February, and males began exhibiting the orange breeding colors typical of Black Darters. In March, the abdomens of Town Creek females were greatly extended, and thus gravid, and male breeding colors brightened, with blue-green additions around the opercular/cheek area and at the caudal peduncle, and along the nape. The fin rays were a brick red, and had multiple striations. Similarly, in early April, Limestone Creek females were gravid, and male colors brightened.

While it appears that physical growth and development may have occurred more slowly at Limestone Creek than at Town Creek, it may be the case that fish at Limestone Creek just grow to a different size than fish at Town Creek. Both sites had females with ripe eggs in January, although the numbers were very small. Although the Limestone Creek sample in January had a smaller proportion of ripe (RE) females than the Town Creek samples, both sites had at least 50% RE females in February. Town Creek females were exhibiting the occasional atretic follicle as early as January and throughout the study. No atretic follicles were found in females from Limestone Creek, but this could have been due to chance of sampling.

During all months of capture, male samples from Town Creek were at an earlier stage of development than samples at Limestone Creek. However, sampling error could have influenced these results. Male darters tend to be ahead of females in terms of growth, and, thus, maturation (Page 1983). It is possible that errors occurred in differentiating Stage IV from Stage V in males. Stage V in described by Leino et al. (2005) as having numerous spermatids in the lumen of the testes. If some males were captured just after releasing their milt they may have been classified erroneously as being in Stage IV development.

There could be several different causes for the size difference between the two populations. One cause could have been the differences in water temperatures between the two sites. While not extremely different, Town Creek had higher water temperatures during the first two months of the study. In the third month of the study, Limestone Creek had a higher water temperature than Town Creek. However, this should not have affected the size of the fish, since most should have been at their optimum size by their March/April capture.

Another possibility for the size difference between the sites could be the food availability for larval development in each habitat. Limestone Creek had a greater depth and swifter current with little vegetation. Town Creek, however, was of shallow depth and a low current speed with heavy vegetation in the capture areas. Heavy vegetation would offer protection for the offspring of many forage species, including insect larvae and crustaceans, a staple in the diet of congeners such as E. simoterum (Page and Mayden 1981).

The total dissolved solids (TDS) could have affected the overall size of the fish in this study. Fallo and Warren (1982) studied another Nanostoma species, E. atripinne, in Kentucky, finding that they were in better condition and more successful in streams with high levels of TDS. Town Creek consistently had higher TDS readings than Limestone Creek.

Many studies have tried to elucidate the spawning season for various darters of the subgenus Nanostoma (e.g., E. coosae, O'Neil (1981); E. baileyi, Clayton (unpublished 1984); E. zonale, Hubbs (1985); E. rafinesque, Weddle and Burr (1991)). Considering the trends in the current study in mean oocyte and mean RE egg size and mass and trends in GSI, the spawning season for Black Darters likely begins in early-to-mid March, with the peak possibly occurring in April and, perhaps, into May. We urge that further research into the reproductive biology of other Etheostoma species be done with histological methods similar to ours to better clarify the seasonal patterns of gonadal growth and function in this speciose and ecologically important North American genus.

Fish & Wildlife Designates Critical Habitat For The Vermilion Darter

2010-12-12T16:05:00.000-08:00

The U.S. Fish & Wildlife Service released its report in the Federal Register last Tuesday designating 21 km of critical habitat for the federally Endangered Vermilion Darter, Etheostoma chermocki. This species is only found in the Turkey Creek system in the northeastern suburbs of Birmingham, Alabama. This habitat designation was in response to a lawsuit brought by the Center for Biological Diversity in 2007. This designation doesn't prevent land owners from doing what they want with their property, but it makes it much more difficult for federal money to be used in the area in ways that might affect the creek and the darter, for instance by highway or sewer construction. So it does have teeth, but not what most people would expect.

I happened to be in that area of Pinson, AL, yesterday on other business so I took some photos of an upstream tributary to Dry Creek, which in turn is a tributary to Turkey Creek. This area has gone through rapid development as a suburb in the last 20 years, creating threats to the creek's biotic integrity including increased sediment run off, altered stream flow, and other physical factors making the creek warmer and more eutrophic in general. This area is at the southern terminus of a long, high ridge called Sand Mountain that runs northeast into Georgia.

So, here are two pictures I took of this area yesterday, about 3 km upstream of the critical habitat designation. The water is clear and flowing reasonably, not always the case at points downstream. The area is overrun with exotic privet and Japanese honeysuckle, symptomatic of profound land use changes.

Manuscript Submission To Southeastern Naturalist

2010-12-10T15:04:00.001-08:00

I just submitted the gill parasites/telescope shiner manuscript to Southeastern Naturalist. It was easier than I anticipated to reformat it for SENA. The title is now, "Impact of a Gill Parasite Upon the Minnow, Notropis telescopus". As always, I hope they like it. But really, who wouldn't like a research article about any shiner species? Let's get real!

Abstract Of My Smithsonian Research Proposal

2010-12-09T14:18:00.000-08:00

I submitted my research proposal to the Smithsonian Tropical Research Institute today for a two week visit in May. Below is my 250 word Abstract for this work:

Parasites are known to be important regulators of energy flow through ecosystems, and also to affect the fitness of individuals. Monogenean trematodes of the genera Dactylogyrus and Gyrodactylus that live in hosts’ gills or on the skin have been shown to be harmful to a variety of fishes under laboratory, aquaculture and natural conditions. In this weakened condition hosts may also have diminished reproductive capacity, measured as smaller functional gonads, lowered gamete production or diminished sexual coloration phenotype. My proposal is to begin a research project on the possible influence of monogenean trematodes on a livebearing Poeciliid fish species, Brachyrhaphis episcopi, endemic to Panama. Previous research on this species conducted at the STRI has shown the species to have life-history responses to the presence or absence of larger piscivorous fishes. Twelve known sites with B. episcopi would be visited and 40 fish collected at each. Fish collected would be examined for how many skin and gill parasites they carry, and would also be examined to determine reproductive condition such as number of eyed embryos carried by adult females as a measure of possible influence of parasite load. This would address two linked hypotheses: one, that higher parasite load is linked to, and possibly causative of, lowered reproductive capacity; and two, that higher parasite loads would be found in host populations that live in environments without predatory fishes such as large characins. Any monogenean parasites found would likely be new species because of the tight co-evolution of these parasites and hosts.

A No From Freshwater Biology, On To Southeastern Naturalist

2010-12-09T09:08:00.000-08:00

I heard back from the Editor at Freshwater Biology today. They declined our manuscript on parasite infections of telescope shiners, basically as lacking broad enough interest. Oh well, that's the risk with doing taxon-specific research. So, I think the next move is to reformat it for Southeastern Naturalist and send it to them. Hopefully they'll like it.

Meanwhile, I've almost finished the research proposal I have to submit to the Smithsonian in Panama to be accepted as a visiting scientist this May. It's like writing a short research paper in its own right.

Cold, High Water At The Flint Today

2010-12-06T17:37:00.001-08:00

We met at the farmers' market parking lot a little after 1 today to run the driftnets at the Flint, with Brian, Robert, Jeremy, Douglas and myself. It was a sunny, cold day, about 5 deg. C, with a steady north wind. The water was markedly higher and faster than last time. In the photo below you can see fresh debris in the tree branches at the upper left; that was from about 12 cm of rain a week ago that flooded local rivers. The shallow area along the bank in the photo has always been exposed on past trips. Luckily there were five of us today, because the current was so strong we had to hold the nets in place for an hour instead of relying on the zinc rods to anchor them. Water temperature was 7 deg. C, which doesn't sound so bad until you've been standing in it for over an hour in uninsulated waders.
The next photo is an awkward shot I took while holding onto one end of the net. The white poles running to the right are Robert's invention to try to stabilize the net by bracing the skinny zinc rods. They helped today because it's easier to hold on to them than the zinc rods, mostly by bracing one against my leg while standing in place. I don't have the exact figure on current flow, but the raw measurement was 447 propeller rotations in one minute, a pretty good clip. Lots of water went through the nets in the hour we held them in place. Water running around and through the net was very turbulent, as you can see.
Finally, here's a view of one our transects. The two nets were set up at two points on the left in this view. High flow has pretty thoroughly scoured the river of any leaves or other debris. And, you can see in the silhouette than I'm in the Australian hat my father gave me. Luckily a leather hat is pretty good at keeping out wind.

More Stripetails At Estill Fork Than We Thought

2010-12-02T06:06:00.001-08:00

Robert spent the afternoon yesterday curating the fishes we collected on Saturday at Estill Fork. Close examination of the stripetails/fantails showed that 7 of 11 are stripetails rather than fantails, reversing our initial assessment. Two traits can be seen in preserved specimens to separate the species: the stripetails have a dark submarginal band on the first dorsal fin, and the striping pattern on the tail is both richer and darker. Also, the stripetails are lighter ventrally and don't have as pointed a head when observed from above. The challenge for us will be to quickly, accurately ID the species when pulling them out of a seine at both the Flint and Estill Fork. We've been kinda OK up to this point with IDs, now I think we can be much more accurate.

We'll be going to the Flint early Monday afternoon to run the driftnets since the new moon is Monday. The high temperature is predicted to be 47 F, so it will be a brisk experience standing around the river. At least the sun should be out.

Estill Fork Had Higher Water, Interesting Darters

2010-11-28T17:26:00.000-08:00

Of course, we went to Estill Fork to find darters and we did. After some rain earlier in the week the river was at a normal level, or even more so, with some water running over the low bridge. So we modified our sampling technique from September. We made eight transects instead of sixteen, each of about 15 meters, and took depth and flow measurements at 1 meter intervals from bank to bank. Most of the flow measurements were well over the zeros we found last time, and as a measure of that much of the emergent vegetation was scoured out.

We didn't net any blotchside logperch this time, but we did find greensides in the deeper, faster flows where you'd expect them and nowhere else. The new species this time was blueside darters, Etheostoma jessiae, found in greenside habitat as might be expected. Both fantails and stripetails were more common this time, too. The tennessee snubnoses are the generalist in this assemblage. We found them pretty much everywhere along transects, from deep, still water to shallow, flowing water and variations in between. Rainbows, the other common species, tended to be in shallow, flowing water.

On question I have is why there aren't banded darters at this site. They're present several miles downstream at the Baptist church site, but I've never, ever seen one at our study site. The major difference between the two sites is that the downstream site is rockier, and the upstream site substrate is largely sand and gravel. And that might be it.

Here's a view of the stretch of stream we were working, with Brian and Jeremy looking at a data sheet.
Here's a broader view of the same scene, with the whole crew: Robert, Alex, Brian and Jeremy.

And finally, Jeremy, Robert and Brian poking around in a seine haul trying to pick out darters while I'm holding the other end of the seine and taking a picture.

Estill Fork On Saturday

2010-11-24T15:59:00.000-08:00

We'll spend much of the day on Saturday at Estill Fork. It will be our second survey of flow, depth and substrate measurements along with netting darters along at least many of the same transects we followed in September. I'm hoping that the rain we've had lately is enough to raise stream flow above the pitiful levels of the last several months.

The Dactylogyrus manuscript is almost ready to go to Freshwater Biology. I have to figure out the best way to send the 4 figures, created in Excel and currently copied into a Word file. They should be sent as .tiff files, or in a PDF or EPS format. I think that PDF is looking better and better for sheer simplicity.

And, Maybe On To Panama In May?

2010-11-20T08:25:00.000-08:00

UAH is trying to establish some kind of university presence in Panama as some form of international campus, which is fine with me in general. To support this they've made some money available for faculty to visit Panama and work on establishing funded research projects. Naturally I stood up and said, "Sure! I can do that!". And it's true. I've proposed visiting the Smithsonian Tropical Research Institute (STRI) in May for two weeks to meet staff scientists and hopefully start a research project. The project would be examining populations of a local livebearer fish, Brachyraphis episcopi, for trematode gill parasites and relating that to reproductive function. A surprising amount of research has been done with this species that shows that different populations respond to the presence or absence of a larger predatory fish in a stream. I'm curious if parasite load varies with such predatory pressure. Plus, as far as I can tell, no one has ever described such parasites from Panamanian freshwater fishes, so there's an unknown swathe of biodiversity to be described. The chances look good that the university will give me a reasonable amount of money to cover airfare and expenses at STRI. At least my passport is current.

Dactylogyrus / Notropis telescopus manuscript almost ready to go

2010-11-18T18:49:00.000-08:00

I think I've finally polished our manuscript on the patterns of Dactylogyrus spatulus gill parasite infections of telescope shiners, Notropis telescopus. It's relatively short, with 4 figures (2 could be combined as 1, really). If both co-authors, Brittany and Andrew, like it as is I'll go back and format it specifically for submission to the journal Freshwater Biology (Brittany told me she thought it was OK). Here's the current version of the abstract:

ABSTRACT: Dactylogyrus is a holarctic genus of trematode flatworms that infect the gills of cyprinid fishes. Dactylogyrus species are usually highly host specific, and little is known about their life history in North America. The purpose of this study was twofold: to determine whether Dactylogyrus exhibits seasonality in its life cycle, and if there is any effect upon reproductive effort of the host as a result of Dactylogyrus infection. We examined 383 Telescope Shiners, Notropis telescopus, collected from Hurricane Creek and Estill Fork in the upper Paint Rock River system in Jackson County, northeastern Alabama, USA, from February to September, 2007, and October, 2008 to January, 2009. A total of 967 Dactylogyrus spatulus were found on the gill arches of fish collected. Parasite counts yielded a peak in the average number of parasites present per fish in May, a significant relationship between host length and infection, and a negative correlation between higher parasite load and gonadosomatic index (GSI). Parasites per fish averaged about 1.5 from August to February, with an average high of just under 6 per fish in May. Chi square tests of the assumptions that parasites are evenly distributed among individual host fish and in each month groups lead to the rejection of both assumptions, with the months of March through July as a prevalence peak for Dactylogyrus infection. These months are the time of gonadal development and reproduction in Telescope Shiners. Both male and female fish with higher parasite infections had significantly lower GSI than fish with lower parasite infections.

The Florida Panhandle Fundulus Might Become A Project

2010-11-13T15:30:00.000-08:00

I received more information from Charlie today about these unusual Fundulus populations in the Florida panhandle. Their distribution is better known than I had realized, and we might be on to something for either a new species or, more probably, an intergrade between F. escambiae to the west and F. lineolatus to the east. Either way it's interesting because it's not just a single creek, but sites spread among three different rivers. This might be the focus of a spring trip in March...

A Gel Of Mostly Fundulus bifax DNA, PCR amplified

2010-11-10T10:26:00.001-08:00

I received the image below from Lance at IXG who is working to amplify and sequence a batch of samples I gave him of mostly Fundulus bifax DNA (and some F. diaphanus). I usually shy away from showing these images because it can get really tedious, but Lance was so excited that all 15 samples yielded very solid bands that you can see, which are all concentrated mitochondrial DNA, the cyt-b gene in particular. He told me I was a really good primer designer, which are short chunks of DNA used to begin amplifications. All I did was find what others have used, and give Lance the information. Anyway, I hope to receive sequences in the near future.

Two Days At The Flint River, AL

2010-11-06T20:08:00.001-07:00

We went out Friday afternoon to the Flint to run driftnets, and back today to do transects for flow, depth, substrate and darters. It's finally cold, certainly when we get there at 9 a.m. We found a blotched chub, Erimystax insignis, today that's a rare species in Alabama streams. It likes fast riffle water over boulder and cobble, exactly where we found it. The Nature Conservancy rates the species as S2 in the state, so we certainly released the one we netted.

Here are Jeremy, Robert and Brian standing around a driftnet yesterday at the Flint. Both nets collected a large number of drifting leaves, not surprisingly.

This is a photo I took while holding one end of our transect tape measure line. Brian is handling the flow meter while Brittany records data. Jeremy is peeking in from the far bank, holding the other end of the tape. We make readings of depth and flow at one meter intervals, with the river being about 30 meters wide.

The Florida Fundulus From Tony

2010-11-04T08:06:00.000-07:00

I received a package of preserved fishes from Tony, finally delivered to me through campus mail on Tuesday. The one individual from the apparent intergrade creek really does look exactly intermediate between the F. lineolatus and F. escambiae also in the package, variously from SC and FL. The specific locale is just to the east of the Appalachicola River which is a famous biogeographic boundary between very similar species to the east and west, so the fact that this intergrade killifish population seems to exist is no real surprise. But we still have to get decent DNA sequences from it, so we'll see.