Cyt-b Gene Sequence Of A Fundulus From Chipola River, Florida

I have a growing number of cytochrome-b gene sequences from a group of Fundulus fish in the lower Appalachicola basin of the Florida panhandle. These are starhead topminnows with a distinctly different phenotype from either F. lineolatus to the east, or F. escambiae to the west. Here's one of the complete 1140 base sequences of a fish from the Chipola River. It hasn't gone through any kind of review, but this is based on a really clean PCR and sequencing with standard primers. Here it is, in 5' to 3' order:

ATGGCAAACCTTCGAAAAACCCACCCCCTTTTTAAAATCGCAAACGACGCTCTA
GTAGACCTACCAGCCCCCGTAAACATTTCCGTGTGATGAAACTTTGGATCCTTA
TTAGGATTGTGTTTAATTGCCCAAATTTTGACCGGGTTATTTTTAGCTATACAT
TATACTTCTGATATTTCTACAGCCTTCTCATCCGTCGCACACATCTGCCGGGAT
GTAAATTATGGCTGGTTAATCCGTAATATACATGCCAATGGTGCTTCCTTCTTT
TTTATCTGCATCTACCTTCACATCGGACGTGGTTTATACTACGGCTCCTACCTT
TATAAAGAAACATGAAATGTAGGTGTTATTTTACTGCTCCTAGTTATGATGACT
GCCTTTGTAGGATACGTTCTCCCTTGGGGCCAAATATCTTTTTGAGGTGCCACC
GTTATTACTAACCTATTATCCGCAGTTCCTTACGTAGGAGATGCATTAGTACAA
TGAATCTGAGGGGGCTTCTCAGTAGACAACGCCACACTCACCCGGTTCTTCGCC
TTCCATTTTCTACTACCCTTTGTAGTGGCAGCCGCTACTATAGTCCACTTAATT
TTTCTTCATGAAACCGGTTCAAACAACCCCATTGGCCTAAATTCCGACGCCGAT
AAAATTTCCTTCCACCCATACTTCTCTTACAAAGATCTCCTAGGTTTCGCTCTC
CTTTTAGCAGCCCTAATCTCCCTAGCCTTATTCTCCCCCAATCTCTTAGGGGAC
CCAGAAAATTTTACTCCAGCTAACCCCTTGGTAACTCCCCCTCATATCAAACCA
GAATGATATTTTCTCTTTGCTTACGCTATTCTCCGATCTATTCCTAATAAACTG
GGTGGGGTCCTAGCCCTGCTAGCATCAATTCTTATCCTAATAGTCGTCCCTATT
CTTCACACATCTAAATTACGAAGTCTAACTTTCCGCCCTCTATCCCAATTCTTG
TTTTGACTATTAGTGGCTGACGTCGCAATCCTAACATGAATTGGTGGTATACCA
GTAGAACATCCCTTTGTGGTTATTGGACAAGTTGCCTCCGTCCTATACTTTTCC
ATTTTCCTGTTTCTTTCACCCGCCGCAGCGACATTAGAAAATAAAATTCTCCAA
TAATAA

Silver Shiners At Another Flint River Site

Last Sunday we went to a new site on the Flint River, about 5 km downstream from our more typical spot. I've been curious if silver shiners exist downstream, and ultimately how far downstream. This site is accessible through a subdivision, with a key needed to get through a gate and down a road that ends right at the river in a picnic ground. One of my student's parents live in this subdivision, so he was able to get a key. And that is a good thing! The river is really beautiful at this site, with steep bluffs on the east bank, a long thin island with steep banks, and more gradual slopes from the west. The first picture is a downstream view from our access point, with Alex and Monica walking to the point where we were able to catch silver shiners with a castnet. Even at low water, the center flow of the river was fast and maybe two-thirds of a meter deep.

Here's most of the group taking a break in the sun. The water was 12 deg. C, and air temperature started lower than that.

An interesting feature of this site is a springfield of about three significant springs, and maybe six smaller ones, bubbling up through the stream bottom with other smaller "jets" of water. The area was maybe 150 square meters, protected from the main flow of the river by a projecting bank. The water was shallow with heavy vegetation. I didn't have the chance to really look, but it seemed to be ideal flame chub microhabitat. This photo was from the opposite side of the river. You can see a pumphouse about halfway up the low bluff, connected to two intake pipes at one of the biggest spring flows. I have no idea who owns that rig.

Here's a view of the river-facing edge of the subdivision. The houses are built on a low natural bluff that I'm sure is above the level of any recent floods. A broad swath of mowed lawn functions as a buffer. Builders don't always resist the temptation to put houses closer to the river in clear danger.

And, here's some of the catch of the day. The two skinny fish with some dark lines on their top running lengthwise are the first two silver shiners of the day. The tiger striped fish at 4 o'clock is a logperch, later released. And the fish at 11 o'clock is one of the largest northern studfish I've ever seen, which I kept for possible DNA examination. We wound up with six silver shiners, five of them caught with the castnet. We also caught some whitetail shiners, a few of which I kept as vouchers. And two seine hauls came up with 30-40 scarlet shiners each, all of which we released. I hope to return to this site over Thanksgiving weekend, water level permitting.