I Finally Have An Entire Fundulus Mitochondrial cyt-b Gene Sequence

Lance and Anthony at IXG came up with a third sequencing primer for getting the entire 1140 base cytochrome-b gene from several Fundulus species. The one below is from a longnose killifish, F. similis, from St. Joe Beach, Florida. It's the first of my batch of five. I've stitched it together from three overlapping sequences from the three different primers. And, it's published here first!

ATGGCAAACCTTCGAAAAACCCACCCCCTTCTAAAAATTGCAAACGACGC
TTTAGTGGACCTACCAGCCCCTGTAAATATTTCCGTATGATGAAACTTTG
GTTCCCTATTAGGCTTATGCTTAATTGCCCAAATTTTAACAGGATTATTT
TTAGCTATACATTATACTTCTGACATTTCCACAGCCTTCTCATCTGTTGC
ACACATCTGCCGAGATGTAAATTACGGCTGATTAATTCGTAATATACACG
CTAACGGAGCCTCTTTCTTTTTTATTTGTATTTATATTCATATTGGGCGA
GGCTTATATTATGGATCGTATCTTTATAAAGAAACATGAAACGTAGGGGT
TATCCTTCTTCTCCTAGTTATGATGACTGCTTTCGTTGGATACGTTCTTC
CCTGAGGACAAATATCCTTCTGAGGGGCCACCGTTATTACCAATCTCCTG
TCCGCCGTCCCTTACGTAGGAGATGCACTGGTACAATGAATTTGAGGGGG
TTTCTCAGTAGATAATGCTACACTAACCCGATTCTTTGCCTTCCATTTCC
TCTTCCCATTTGTCGTAGCAGCTGCTACTATAGTACACTTAATTTTCCTT
CATGAAACAGGATCTAATAATCCAACGGGTTTAAACTCCGATGCAGATAA
AATTTCATTCCACCCTTACTTTTCTTACAAGGATATTCTAGGTTTTGCCC
TTCTTCTAGCAGCCTTAATTTCTTTAGCCTTATTTTCCCCTAATCTCCTT
GGAGATCCTGATAACTTTACACCAGCCAACCCTTTAGTTACTCCCCCTCA
TATCAAGCCTGAATGATATTTCCTTTTTGCCTATGCTATTCTTCGATCCA
TTCCTAATAAACTAGGAGGAGTATTAGCCTTATTAGCATCTATTCTTATT
CTTATGGTAGTTCCTATTCTTCATACATCTAAACAACGAAGCCTTACCTT
CCGACCTCTAACCCAATTCCTATTTTGACTTCTAGTAGCAGATGTTATAA
TTCTTACCTGAATTGGTGGTATACCTGTAGAACACCCCTTCGTAATTATT
GGTCAGGTTGCTTCCTTCCTCTATTTTTCCCTATTCCTGTTTCTCTCTCC
TGCCGCAGCATGATTAGAGAATAAAGTCCTTGGATGATAA

We Found Fish And All That At The Flint

We put the new flowmeter to work at the Flint River today, and all is well. I had to leave after the first transect (following driftnetting) to go to a Master's report presentation. On that transect we found a bunch of banded darters in the middle of the river, a few scattered black snubnoses, and then a bunch of redlines in the fast flowing side channel over gravel and cobble. It was an impressive example of niche partitioning.

I got DNA data back from IXG, it looks like the third primer they designed for me for sequencing the mitochondrial cyt-b gene of Fundulus species works. I still have to open up that data set and look closely, but I think what they sent me fills in the gap in the middle of the sequence. So now I can move on to the Telogia fish, I hope!

Everything's OK, I Have A New Flowmeter

The new flowmeter arrived yesterday. The only difference between it and the original one is that the new one came in a green rather than a red box. We'll use it on Friday at the Flint, where we'll attempt to do both driftnetting and transects for Brian. The challenge will also be to park in a believable place since the Farmer's Market doesn't want us to park on the edge of their property anymore. We can park over by Brier Fork and march down, which in warm weather isn't so bad. We'll see what happens this winter.

I also heard from the journal American Midland Naturalist about the 11-KT in scarlet shiners manuscript Jennifer Schade and I submitted last winter. They're happy to publish it with, of course, the caveat of some revisions. It's always humbling to see what clunkers you leave in a manuscript for other people to find (like spelling Anderson as Andeson in the Bibliography). But it's a fairly short list, so I hope we can turn it around and send it back to them in a month or two.

A New Flowmeter Is On The Way

I've had an adventure the last two days trying to order a replacement flowmeter since I think we drowned the old one last Friday. I called Forestry Suppliers in Jackson, MS, to try to order one from them since I got the original one from them last September. It didn't show up on their on-line catalog, and the person I talked to on the phone wasn't familiar with it, nor were the available techs she asked; one finally said they used to carry it. So OK, I'll just order it from the Geopacks HQ in Devon, England. The Geopacks phone number wouldn't connect, although I could get their FAX phone, and I finally sent an email to their service department. They were willing to sell me one and ship it, but the lady I corresponded with found it odd that Forestry Suppliers didn't have one since Geopacks continues to ship to them. Geopacks called Forestry Suppliers, found out that they did indeed have this flowmeter, and they sent me an email with a name and number to call. The lady at Forestry Suppliers was apologetic, connected me to their sales line, and I ordered a new flowmeter just an hour ago that I should have early next week. Phew! We need it for going out to driftnet in the Flint next weekend on the new moon, and we're also due to run transects there for Brian's work. So all's well for the moment.

Transecting In The Rain

We made it out to Estill Fork yesterday to do our transect sampling for Brian's project. The stream was still high from rains the previous two days. We were able to finish three of the typical eight transects we do before a sustained rainfall started. That was OK, we're tough and all that, but the flowmeter got a little wet at the connecting jack and stopped working, which pretty much ended the day since a key part of the working is relating stream flow to darter presence. I have it drying out in a dessicator jar, and hopefully it will work again without any heroic electronic work. It's a fairly simple device, but if it's dead we seriously face having to buy a replacement to finish this work, a mere $250. We were catching interesting fish even in the relatively deep water, including several blotchside logperch, a surprising number of greensides, and along with the usual suspects we caught johnny and blueside darters. I think we did enough work so that the data will suffice, even a little bit short. My cell phone got a little wet and stopped working too, even in a cooler, but luckily has snapped back.

Yeah, There Are Lots Of Silver Shiners In The Flint River

I went out this afternoon with the Ichthyology class to our Flint River site with a primary goal of catching more silver shiners. My guess was that they would be in the slightly deeper flowing water over sand just below the riffles we usually work, and sure enough, we caught 16 very quickly (along with a 6-inch smallmouth bass). I kept 9 of these fish, 3 in ethanol and 6 in buffered formaldehyde, as vouchers of their existence. In one net alone we caught 12, at which point we stopped. So, once again, we found what is one of the most abundant species in the river but has been unreported as being present. Just like most fishes the silver shiner has a very specific habitat preference, described above, and when we set up a seine in that habitat there was obviously no shortage of the species. This is the second well-documented site for this species in Alabama, along with Sugar Creek off of the Elk River. They probably also are present in the Paint Rock River, based on a credible report from Matt in Maryland. None of this is surprising that they're present in these northern tributaries to the Tennessee River, it's only surprising that what is probably a common species in these places has gone unreported for so long. But, that's the state of ecological work in Alabama, it's a very rich area for biodiversity but is still surprisingly unexplored.

A Push For Silver Shiners, And Telogia Fundulus DNA Too

I'm going back to the Flint Tuesday afternoon with the Ichthyology class to look for Silver Shiners. We'll take my old 20-foot seine with relatively coarse mesh, and work the flowing pool below the riffle system. The river is fairly low even with rain yesterday so I hope it won't be an heroic effort to find more silvers. We'll probably find something else new to me in the Flint too, at the rate we're going.

I'm ready to start extracting DNA from the Telogia Fundulus fish Charlie and Tony sent me from the Florida panhandle. I have a total of 52 of these fish from 10 or 11 sites, and an extraction kit good for 50, so I'll use most of the kit. I have to keep a few as untouched vouchers. I think the protocols I've worked out with IExpression Genetics for PCR and sequencing will work, I hope to know fairly soon.

Thoughts About The Flint

First off, a photo of the Flint last Friday. Two rainstorms in the previous 10 days did a pretty good job of scouring out the obnoxious green algae bloom that we saw at the time.

As to thoughts, I got a second opinion from Dave Neely that the silver shiners we caught there were, indeed, silver shiners. That leads me to think it's worth pursuing their status in the Flint, since this is a new record and is pretty much the southern edge of their range. The state of Alabama rates the species as Low Conservation Concern (which means they should be monitored, as opposed to there is no reason for concern), while the NatureServe system lists the species as S1, Critically Imperiled, in the state. I've also heard a credible report that the species has been seen in the Paint Rock, so that would be good to follow up too.

On Friday we netted large numbers of juvenile blotched chub, Erimystax insignis, along with more adults that we've seen before. This is another species at the southern edge of its range, and is also rated as Low Conservation Concern by Alabama but as S3, Vulnerable, by NatureServe. The fact that there seems to be a healthy breeding population at our site makes me think that this species is worthy of more study in the Flint, too. For these studies all I have to do is to find a student or two willing to help, and see what we find. We'll see...

Fun In The Flint

We ran driftnets in the Flint yesterday since it was the new moon. We also did a lot of seining, looking for black and banded darters for Kara's project. Strangely we found almost no bandeds, although the blacks were easy. Above is a big hogsucker we netted, he was so pale when we netted him I thought he was a white sucker at first. He was released after photographing him. We also netted a big gar, spotted I think, and could have netted another two gars. That's a first for us at the Flint!